Contig Sequence

Contig name: BC000033353 (Nimblegen Contig name: CONTIG45540)

Contains SNP BS00090490 at position 158 (ambiguity code highlighted in red in the sequence below).

CTACAACGCTGTTAGGAAGCACTCGCCTACGGCCTATGTGATCATGTCCAACCGAATTGCAGGGGATTGGGAACGAGCTCGTCGATTTTGCCTCACCGTTCAGCAGAACCGTCCTTGACGGGCACCCCTACCTGGTGTTCGAACCCAAGTTGGACAA[M]TCCAATGTGCAGCAGAACATCGATTTCGTCAACAAAGAGATCGCCGGTGATCTCAGCAGCATGACAAGGCCAGATGGCCCTCTCACTTTTGTTGGTGAATGGGTGGCTGAGTGGAAGGTAAAGGGTGCTTCGAAGGAAGACTTCCAACGGTGTGCAAATGCTCAGATGGCTGTGTATCGGAAAGCCACATTTGGATGGGCTTACTGGTCGTACAAGCATGTTAGCAACCACTGGAGTATGGAGTGGATGATCAACAACGGATACATCTCCTTAAAAAATGCTTGAGGCAACTAAATTTGCAACTATGAACGGAAGAGCTGCCAACTATTGGAGNNNNNNNNTGTATGAGAGGGAACTGATGAGCACTTGGCGCCTCAAGATATTATTAATGTAATATGATTATGTTGTTTAATGATTTAAGTAGTATTTGTGACATTATTCACCACATGAGCCAATAAT

Note: The ambiguity code M, highlighted in red, translates to A or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 18 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00090487 125
BS00090488 127
BS00090489 137
BS00090490 158 1D 1.61 1D 2.58
BS00090491 279
BS00090492 283
BS00090493 290
BS00090494 310
BS00090495 323
BS00090496 338
BS00090497 387
BS00090498 396
BS00090499 409
BS00090500 425
BS00090501 429
BS00090502 444
BS00090503 456
BS00090504 462


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.