Contig Sequence

Contig name: BC000032309 (Nimblegen Contig name: CONTIG28663)

Contains SNP BS00086322 at position 474 (ambiguity code highlighted in red in the sequence below).

CTTAGTGATCTTCCTACACTGGTGCTCATTGGTCCTGATGGGAAGACACTGAGCAGCAATATTGCGGACATAATTAATGAGCACGGTTTGGATGCATGGGAGGGGTTCCCCTTCAATGCAGAGAAGCTGGAAATTCTAGCGGAGAAGGCAAAGGCTAAAGCAGCGGCACAGACATTGGAGTCCCTTCTGGTTACTGGTGATATAGACTTTGTCATCGGGAAAGATGGAGCAAAGGTTCCTGTAGCAGAACTTGTTGGGAAGACTGTCCTCCTCTACTTTTCAGCTAAATGGTGTGGGCCATGCAGAGCCTTCCTGCCTACACTTGTGGATGTTTACAACAAGGTCAAGGAGAAGAACAGCGATTTCGAGATCGTCTTCATCTCTAGCGACAGGGACCAGAGCTCATTCGACGACTTCTTCTCTGGCATGCCATGGCTCGCCGTTCCCTTGGAAGACGACAGGAAGGCGTACCT[R]AAAAAGAAGTTCAAGATCCGCGGAATCCCTTCTCTCGTCGCCATTGGTCCCGATGGGAAGACGGTCAAC

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 12 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00086314 21
BS00086317 27
BS00086323 75
BS00086324 84
BS00086313 165
BS00086315 217
BS00086316 245
BS00086318 343
BS00086319 375
BS00086320 442
BS00086321 444
BS00086322 474 2B 87.20



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.