Contig Sequence

Contig name: BC000030663 (Nimblegen Contig name: CONTIG07314)

Contains SNP BS00079858 at position 224 (ambiguity code highlighted in red in the sequence below).

CCAGGAAAACAACCAGATCCAAACCCTCAACCATTACCAGACCCACAACCACTGCCGGACCACGACCAGACCCAAACCCGCAACCACTACCCGAGCCTAAACCAACCCACAACCACTGCCAGAGCCACAACCTGATCCAAATGCTCAACCATTACCAGGACCACACCCTGACCCAAATCCACAACCATTGCCAGGCCAAAACCTGCAACGGTTGATGAACCCA[Y]GGCCAAACCCAAACCCGCAGCTACTACCAAACCCACGGCCAAACCCAAACCCTCGTCCATTACCAGGACCGCAGCCTGATCCAAATCCACAACCATTACCAGACCCAAACACAAAACCATTGCCGGACCCACAACCAAACCCAAACCCTCAGCCATTACCAGGACCGCAGCCTGATCCAAACCCACAACCATTTCCAGACCCAAACCCGAAACCATTGCCGAACCCACAGCCAAACCCAAACCCTCAACCATTACCAGGACCTCAGCCTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCCATTACCAGGACCGCAGCCTGATCCAAACCCACAACCATTACCAGACCCAAACCACAACCACTGCC

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 21 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00079852 139
BS00079853 159
BS00079854 163
BS00079855 166
BS00079856 178
BS00079857 209
BS00079858 224 6A 4.89
BS00079859 240
BS00079860 260
BS00079861 282
BS00079862 301
BS00079863 302
BS00079864 330
BS00079865 364
BS00079866 370
BS00079867 389
BS00079868 391
BS00079869 393
BS00079870 407
BS00079871 437
BS00079872 439


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.