Contig Sequence

Contig name: BC000024294 (Nimblegen Contig name: F0Z7V0F01ASVGC)

Contains SNP BS00063145 at position 354 (ambiguity code highlighted in red in the sequence below).

ATCCACCTGGGCGTGCGTGAAATACCAAGGTTACACGTCATGCCACGCTGGACAGCCAAGCCGCTCCAGTGCCAGATGCACTGCCGCGGTGAACCTCGGACGGACACGTGCCAGCAATGCAGGCACTCCGCGATGCATGACCAGTTCATAGACCTAGCGCGCCTAGCCTGTGAGGATGATCGGTGCTACGAGATCGTCATGAGGGGCATCGGCAAACTGAACAGAGAATTGGCCGCAGCAGAGGCCGTGCCCTGCCGCCGCAGGAACAAGCCGGCGTCACGGAAGCCGAGGAGGAAGCGTTGATTACTTGCCCCCGGATGTCTGAAAGCCTGTCCGAGGCCTCTGCAATGCTT[S]GCAAGGCACGGTCTTTTGGGTTTCTTATTTTTGCTAGTGTGGGTAAACTTCTGAACCTGACCACGTATGAACTAGGCTAGACCAGTAGTATATTTACATGTTCGGCAACGGCCTGGCACCATGTTTTT

Note: The ambiguity code S, highlighted in red, translates to G or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 19 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00063144 31
BS00063147 63
BS00063148 69
BS00063149 76
BS00063150 87
BS00063151 90
BS00063133 107
BS00063134 129
BS00063135 130
BS00063136 133
BS00063137 148
BS00063138 165
BS00063139 193
BS00063140 195
BS00063141 234
BS00063142 253
BS00063143 264
BS00063145 354 1D 46.79 1D 73.73
BS00063146 403 1D 46.79 1D 73.73


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.