Contig Sequence

Contig name: BC000014829 (Nimblegen Contig name: CONTIG23401)

Contains SNP BS00032076 at position 865 (ambiguity code highlighted in red in the sequence below).

TCAGATCCCGCGCGGCTGGCCCGTGCGGGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTCCGGTGATCGGACCCGGGCCCGGGCGGGATGGCGTGGTGGTCGGACAAGCTGTCGCTGGGCGGGCTGCAGGACATCGCCGGGGCTGTCAACAAGATCAGCGAGAGCGTCAAGAACATCGAGAAGAACTTCGACAGCGCGCTCGGCCTCGAGGAGAAGCGCGACGACGCGGAGGAAGGGTCAGGATCCCGTACATCTAACTCTGATGGAATTGGATTCTTTAATCCTGTCATGGCATTCATGGGACATAATGGCGAGGAGAGTTCTACGGAAGTATCAGAAAAGCAACCATCACCAAAACATTCACCAGGCACTAGAAGAAAATCATAGGGTCACCACCGAGCCACCTACATCTGAAGCAGATGCTTCTGAAGTACCAGTAACAACACAATCCCCAAAGCAGCCTTCAGAATTACAAGGAAACGTTAGCAGCTCCGCTGAGTCACCTGTATCTAAGGCGGATGGTTCTGAGCAGTCTGTAGCACCACAATCTCCAACACGTTCTTCAGCAGCAGAAGATAAGCATGATGGCTCCACTGAGGCACCTGCATCTGAGGGGGGCACTTCTGAAGTATCAGAGACAGCACAGTCCTCAACATATCCATCTGTAGCAGAAGAAACTTATAGTGGATCTGTTGAGACCAGTAACTTAGTTGAGAAGGAAACCCAGGGTCATCAAGACACTGAATATTCTGATACTAATGAAGAAGCTTTACTGAGTCAGCCTGGTGGGTCTGTTAGGGACATACCTGATGATAG[M]ATGTCTTCACCTAACAAGTTGGATCAATCAAGTGTTATGGGAACAGAAGAATCTGTGGATGCTGGAAATGAAGTCA

Note: The ambiguity code M, highlighted in red, translates to A or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00032058 395
BS00032059 399
BS00032060 463
BS00032061 523
BS00032062 532
BS00032063 541
BS00032064 550
BS00032065 552
BS00032066 564
BS00032067 570
BS00032068 587
BS00032069 603
BS00032070 606
BS00032071 648
BS00032072 654
BS00032073 658
BS00032074 757
BS00032075 852
BS00032076 865 1B 119.85 1B 48.04
BS00032077 867


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.