Contig Sequence

Contig name: BC000002097 (Nimblegen Contig name: CONTIG99567)

Contains SNP BS00003880 at position 61 (ambiguity code highlighted in red in the sequence below).

CCCGGCCGAGTCGCACACAGAGGCTGCAGTTGCACGAGATGGAGAGTGGCAAGAAGAAGG[Y]ACTCGGTGTGGTTGCTGCATTGGTGGTTCTGCAGCTGCTCATGGCAGCTCCGATGGCCATGGCCCGCTACCGCCGGCTCTGGAGGAGATGGCGCGCACAGAAAAGATAGCAATTGAACGCCTCATTCTGGAAACACCGGTAGAAGGCCGCAGTTGCGGCAGGGAAACATGTTATATTAGTCCGTGCTACACCCCTGGTTGCTATTGTACCTACCCTCTCTGTATGAGGCCATCAGTGGTTCCTGCTTGAAGCTACTTGATCAACTCTTCCATCCATGGGACCCTAAGGAAATATGAATGTTGGAACGAGGTACGTCATGGTTGCTTTCTCTCTCGAGACATACTCCGAGTGTGAATTATGTATGGGGAGATGTGGGTAAGGGTGGTGTTCTGCTACTATACCTATGTTTGGGGAATAAATAAATGACATGTGTATGGGAGATGTGTGTATTTGTGCTACCATGTGGCTATGTAATATGTATCTTTCATATATATTGTCTTCNNNNNNNCATCTTTAAATAACATTATCTCGGTCAAATGTAAACCTCGGCCGCGACCACGCTAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTAT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 13 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00012073 53
BS00003880 61 1B 28.77
BS00010076 78 1B 28.77
BS00009485 129
BS00011664 134
BS00009408 142
BS00010135 160
BS00011680 162
BS00012067 292
BS00011439 300
BS00003670 491
BS00003930 491 1B 28.77
BS00003911 516 1B 28.77



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.