Contig Sequence

Contig name: BC000037484 (Nimblegen Contig name: F0Z7V0F01DW14Z)

Contains SNP BS00110231 at position 333 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTGGGGGGCGCAGCAGATGAGCAGAGGCAGATCCACATCTTGTAGCAGTGCAAGTGCAGAGCCTAGCAAGCTCAACCAACCTCCCGTTCTACCTCAGAGTCAAGATGAACAAGGTGAAGAGCCATTGCCATGGGAGGCAGCACCGGGGAGGATCCGGAGGGCTGAGCAGGATGCTGAGGGAGCACAAGGCCAGGCTCTACATCATCCGCCGATGCGTCGTCGCGCTCCTCTGCTACCACGACTAGCAGATCCACCTCTGCTTTCCTGCTCCCCATCTAATTCTTCATTCTAGCTAGGCGTGTGTGTACATA[K]GTAGGGTAGTTCAAGAAGTTCATGCTGCTGACAGCTAATTTGGATGTCCAAGTTTTGGTGTGATGTGGTTTGGTGCTCCGTCCTAAGTCCTGCAATGGCAAGGATGGGCATG

Note: The ambiguity code K, highlighted in red, translates to G or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 22 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00110242 114
BS00110224 140
BS00110243 170
BS00110244 194
BS00110245 203
BS00110228 212
BS00110225 217
BS00110237 235
BS00110227 236
BS00110229 245
BS00110238 266
BS00110239 267
BS00110240 268
BS00110241 272
BS00110226 298
BS00110230 306
BS00110231 333
BS00110232 375
BS00110233 412
BS00110234 413
BS00110235 422
BS00110236 440

This contig has been mapped provisionally to chromosome 1BL.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.