Contig Sequence

Contig name: BC000036847 (Nimblegen Contig name: CONTIG94197)

Contains SNP BS00107235 at position 431 (ambiguity code highlighted in red in the sequence below).

TCCCCGCGTTGGTACCTCGTGCATTGCCGGACGGATGATGCGATGCGTGTCCTACGAGACATAGCGTCCACCAATGGCAAGAGCATCCCACATTGCGTGGGGCTCATGCTAGACGACGAGGACGACATCGCCAAGAAGGTTGTGGAGACGTCGTCGGTCTTAGATGTGTTTCGGTCGCAGATAATGCGGGCTAGGCTCATGCTCTTAGTTATCATCACCTTTCTTTGCTCAGTGGTGTACTTTGGGTTGACCCTCAATGTGGTCAACCTAAAGATCAACCTTTACATCAGTGTGGTTGTTAACTCTCTCGCTGAGATGCCTTCATACCTGGTCACTGCGGTGCTCCTTCAACACTTCGGCCGGAAGCCACTCACAATTGGCTCGATGCTTCTCAGCGGCGTCTTCTGCACAACTGCTAGTCTTATTCCCG[R]CTTCGGTGCCATGAGGGTGGCGAGGATGGCATGTGGGGTGGTCGGGATCTTTGGAATGGCGGGAACATACAACCTATTGCTCGTATATGCGTCAGAGTTGTTCCCAACGGTGGTGCGTACCGTCGCACTGGGGTGCAAGGCACAGGGGTCACAAATGGGGGCCATACTAGCGCCCATAGTGGTGTTGCTCGGCGAGCGGGTGCCATTCGTGGTGTTCGGCATGTTGGCCATCATCGGTGGGCTATTGGTGTTCTGCCTCCCGGAGACTATGAATAAGCCTTTGTATGACACCATGGCTGGTATGGAGAAAGGGGAGAGATCATCAAAAAGGGGAGATGAAGTTGCAACTAGTAACTCCCTAATCTAATCACTTAGGCTAAAGCATTGGCGCACTGAAATATCATTGTTGCCCATAAAACAATGTTGCACAAAAGAGGGAATCGCACAAATTGGATTGTCTACTTGTTTTAGCTTGGGATATGTCTATACATTGTTTCAT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00107223 123
BS00107224 173
BS00107225 180
BS00107226 181
BS00107227 190
BS00107228 258
BS00107229 309
BS00107230 330
BS00107231 357
BS00107232 363
BS00107233 376
BS00107234 421
BS00107235 431
BS00107236 494
BS00107237 537
BS00107238 561
BS00107239 574
BS00107240 583
BS00107241 584
BS00107242 621

This contig has been mapped provisionally to chromosome 2DL.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon