Contig Sequence

Contig name: BC000035999 (Nimblegen Contig name: CONTIG87980)

Contains SNP BS00101456 at position 125 (ambiguity code highlighted in red in the sequence below).

GTTACTGTGTATTTCATTCAGATATTTGAGCTAGTTCAACGACACTCTTCATTTAAATATGACACTAGCAAAATATAACTGAAATTATTTTACATTCCTGAAACATACCAGATTCTACAGTCCA[R]TACTAACAAGTAATCTCAGCCATCTGAGACTGAGGAGTGATGTTGGGAGTCACTGAGGAAGATCCTGTGTATCTACCTCTCAATATGTTCATGCAATATGTTCCTGAGCACGAGAATAGATTTCCGGAACCCGCCCAAGGTTCCTAGCAGGCTAGAGCAAACTCTTCGCTTCGCAAGTTCCTAATGAACGTCACGCCGAGAGCTGAGCTGCTGCATATTTTGAGTTTGCAGCTGCCAAAAGTGCGGCACCGATCCCCGAGCCGTCTTTCGTGTGCTCGACGACAATGTGCTCCATGTCCCGGGGACCAAGAAGCTCCGCCATAGCCTCAACCATGTACGACCTGTACTGAGGGTAATTCTCGTAAAGTCCGCCGTCCATCGCTACCACTGTTCTTCTCCCCAATATCAGTCCCTTGGAATCATTCTCCATCTTCTGAAGAATGCCAGCAACGCCGGCGCCAGCCAACCGCCCGCCTCTCTTGACGATGCAATCGGAAACTTCTACGATAACCCTTCGTGCCGCTACAGAAGATTGGTTGACCCCGATGATGTCGCGCAAAATTGATTCAACTTCTCCAAGATCGTCGGAGTTATCTTGTTGCATAGCACACAAATGCGGAGTTCTTAGAACAAATGGCTCAGCTAGTTTGTCAGCGAACGAGTGACCGAAAATATCAGACTCGTGAGCCATCTTTCCCAGCACCCTCCGGACTATTTCTCCAAGGTACATCCCGGAGATCGTCTTCTCAAATATCTGTTCACCAGGATTTATGCTCTCAGCATCCATGTTCCTGTCAAATTCAGTTAGTGGAAGACCATCTGAAAAAG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 25 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00101456 125
BS00101457 152
BS00101458 293
BS00101459 294
BS00101460 344
BS00101461 355
BS00101462 361
BS00101463 379
BS00101464 388
BS00101465 391
BS00101466 394
BS00101467 433
BS00101468 436
BS00101469 460
BS00101470 496
BS00101471 528
BS00101472 576
BS00101473 583
BS00101474 598
BS00101475 612
BS00101476 613
BS00101477 634
BS00101478 636
BS00101479 646
BS00101480 651

This contig has been mapped provisionally to chromosome 2BS.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon