Contig Sequence

Contig name: BC000034042 (Nimblegen Contig name: CONTIG57107)

Contains SNP BS00093037 at position 466 (ambiguity code highlighted in red in the sequence below).

GTTCAACAAGGCGTATGGGATGTCGGCATTCAAGTATCATGGCACGGACCCGCGCTTCAACCGCGTCTTCAATGAAGGGATGAAGAACCATTCCATCATCATCACCAAGAAGCTCCTTGAATTGTATAAGGGCTTCAGTGGCCTCGGCACCCTCGTGGACGTGGGCGGTGGCATAGGCGCCACCGTCGGCGCCATCACCGCCCACTATCCCACCATAAAAGGCATCAACTTTGACCTTCATCACGTCATCTCCGAGGCTCCGCCGTTCCTGGGTGTCACCCACATTGGTGGAGACATGTTCCAAAAGATTCCCTCGGGGGACACCATCCTCATGAAGTGGATCCTCCATGACTGGAGCAACGAGCATTGTGCAACGCTGCTTAAGAACTGCTATGACGCGCTGCCGGCGCACGGCAAGGTGATGCTCGTGGAGTCCATCCTGCCGGTGAACCCGGAAGCCACGCC[K]GAGGCGCAAGGGGGGTTCCGATCTGGACATGATCATGCTAGCGCACAACCCGGGTGGCAGGGAGAGGTACGAGAGGGAGTTCGAAGCCCTGGCCAAGGGTGCCGGGTTCGGAGCCATCAAGACCACTTACATCTACGCCAACATATGGGTTATCGAGTTCACTAAGTAGACGCATGACAATGTCCACCGATATCTTGCTCATTGCCGCTCCTAAATATGCACTATCTTTCGTTTTCCTTATATTATGTCTTCGTTAACATTTTATGCTTTGAATCATTCCAAATACTATTGTTGTGTCCTCTATTGTTTG

Note: The ambiguity code K, highlighted in red, translates to G or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00093027 122
BS00093028 127
BS00093029 145
BS00093030 169
BS00093031 289
BS00093032 316
BS00093033 320
BS00093034 349
BS00093035 409
BS00093036 427
BS00093037 466
BS00093038 540
BS00093039 560
BS00093040 569
BS00093041 572
BS00093042 575
BS00093043 610
BS00093044 617
BS00093045 637
BS00093046 653

This contig has been mapped provisionally to chromosome 6AS.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.