Contig Sequence

Contig name: BC000030692 (Nimblegen Contig name: CONTIG07993)

Contains SNP BS00079989 at position 84 (ambiguity code highlighted in red in the sequence below).

AGTTCTTGCTGCAGGTCGGGCTGAAGGGCGGCATCATGACTCTGATTGTCCTTCTTTCTCGTGCGGCCCTCTTGGAAATGTAT[Y]GTCCCCATTTCGTCAGGCAAGTGATCCGCCTGGCTGCGGCTATCGATCTTACGAGCTGGTTTGCAGTGATACCAAGGCTATGATTCACATCGGTGATGCAACATACTATGTGTCTGCCATCAACTACAGTGGTTCTTCCTTCTGGGTCATCGATGCCAACATGGATTTACACAACAACTGCCCTCTACCTCGGTGGAATCCTCCATACCAACCCGACAACATGGAAATCGAATTGAGCCCCCTTGTACATAGTGGGGCTTGCTTTGTAAAATGCTCTCAGGAAGTAAAGGGCACTGGTACGTACATGCCTGTTGCTTGCCTAAGCACCAACGATTCTTTTGTTTACGTGTTAACTGGCTATGGGTCTACATATATGGAGTACCTTGAACCTTCTTGTGGGTACTTGGCCCGGACTCCTCGACCCTGGGACGGTCTGGGGCTAGAAAATGCAAGTTATGCAGATGTTGTAAAATCCATGAGGATTGGATTTGCTGTTCGGTTTCCTTATCCTAGGGAGAGCATCAAGCAATGCCTAATACAGACTTTTTGGCCCTTCTATGAGGTACCAGTCTTGAGTAAAGAAGGCATCAAGTTACGTATTCTATTCAGTCTTGTGGGTGATTCATTTTTCTCGCGGTGCGCACTAGTTGATGTCATTGGATTTCCACCATTTCGAGGTGTAGTCATAATAATCGTCTTCTGGATTTGGAAGTGGCTGGCTGTGTTGTGCAGGTTCGTGTTGGCGCCGCTTGTTGTGTTGATTTTCCTAGCCTACAAGTACTGGAAAACAAGAATAACAA

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 15 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00079989 84
BS00079975 276
BS00079976 294
BS00079977 314
BS00079978 345
BS00079979 362
BS00079980 385
BS00079981 415
BS00079982 416
BS00079983 445
BS00079984 461
BS00079985 466
BS00079986 505
BS00079987 518
BS00079988 553

This contig has been mapped provisionally to chromosome 3B-.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon