Contig Sequence

Contig name: BC000024491 (Nimblegen Contig name: F0Z7V0F01CN0F6)

Contains SNP BS00064620 at position 326 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGGAAGTTGGAGGTCACCACACTGCACCATAGAGAGTTCCTTAAGCGTGCAAGGGAGTAGTCCACCATCAACCTTCTGCATCATTCTCAATGAGTAACAGCACCCAATACGAAATTCTGTAAGATCATTCATGCTCCCAAATGATAAAGGAGCATGGATTAGTTTTTTACAGTCAACAATCTTTAGGATCCGAAGAGTGCAGATATAGTGTTCGCGCATTAGAAAGCTCTCTGCCAACGTAGTCAAATTTGAACAATTGCTGATAATGACTGATACTAGCTTGGGTGGCATGGCCTCAGAACCAA[Y]GTTATCATGGTGGGCAACAATTCCCGGGAGGATGTCCAATCCAACATTACTTATTTCTAGCTGCATCAAAGTCAGAGGTAGAAGTGGTAGTTTCCTTAATCCCTGGCATCCTTCCACCACTAGGGTTTTCAGATTTTGAGGAAAGGAATCAGCAG

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 16 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00063816 95
BS00063810 116
BS00063811 152
BS00064617 152
BS00063812 183
BS00064618 183
BS00063805 235
BS00063813 235
BS00064619 235
BS00063806 324
BS00063807 325
BS00063814 326
BS00064620 326
BS00063815 332
BS00063808 339
BS00063809 344

This contig has been mapped provisionally to chromosome 6BS.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon