Contig Sequence

Contig name: BC000024668 (Nimblegen Contig name: F0Z7V0F01CF4FX)

Contains SNP BS00064423 at position 239 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGGTCTGTGGCTATGTGCCACACAAGGACAATCTCGTCGAACGGTAGGTTGAGGCTCCAACCGAGTTGTTGTCCCAGCTGAGGGTGCTTCGACAGAGCCTGTTGTCCCCTGAGATTGTTGAATCTTCTGTATGTGGCAGCATCATGTATGCACTCCCACCCATCTTTTATGTACCGGCGAATCAACCCTTCAATCTCAAAGGCCGCAGGCACCTGCCA[R]TTGTACCAATGCTTGTTAGTGTACTCCCTGAAGCACTTGAAGGCAGCAAGTTTCATCAAAGTGGTGGGCTGCTTCTTGCGAGCACAGAAGCACATGAGATTGTGCTGTGAAACCATGTCTGGCCAAGTAGCAGTTTTGCTTCCGAGCCTGAGCACAAAGGGCAACAATTGAATCATGACTGTGCAAGCAAACAGGATGTATGATACTATCACGTCGTTT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 22 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00064425 26
BS00064431 62
BS00064432 71
BS00064433 90
BS00064421 92
BS00064420 102
BS00064422 128
BS00064437 195
BS00064434 204
BS00064438 229
BS00064439 238
BS00064423 239
BS00064435 255
BS00064424 257
BS00064440 260
BS00064441 284
BS00064426 285
BS00064427 309
BS00064428 323
BS00064429 330
BS00064436 370
BS00064430 385

This contig has been mapped provisionally to chromosome 2AL.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon