Contig Sequence

Contig name: BC000023656 (Nimblegen Contig name: CONTIG98117)

Contains SNP BS00060773 at position 557 (ambiguity code highlighted in red in the sequence below).

GGGGGTCCGATGCCTTTATGCAGCGACTGCGAGACGATGTGCCGTACCAACTGCACCGCGGAGGCTGAAGCCAATTGCGCCAATTACTGCTACGACACCCAATCAACAGCAGGGTACTGCGAAGGTTGCATGGGCGCCTACTTCGACCAGCACTGCAATCCCGAGTGTCTCAAAAATTGCAGCAACGGCTGCAAGAAGAAGGTGCTTCCGAGGCCTTTATGCAGCGACTGCGACACGGTATGCAGTACCAAGTGCACCGAGGAGCTTCAAACCACCTGCAGCGAATACTGCGACTTCAGCCGCAGCGGTCTGGCGGACTGCCAGCGTCAGCTCTTCGAGCGGTGCAACACAGAGGGTACCTGCTGCAGTAGCGACGGCACATGCACTTGTGACTGCGAGACCGAAGCTCGAAAGAGTTGCGTGGGCGTCAGCGACAACTCCAATAATTGCGAAGTTTGCAAGCGCGGCCAGTTTGACCAGGACTGCCATCCCACCTGTAACACCGACTGCAACAGCAACTGCAAGAAGAAGAAAGGGTGCCACGGGCACGCATAGG[R]AAAACATGTAATCGGGTGTGCCCTGCATTGCATAGGAATAACATGGCTCCCTCCCCTGTAGTCGTGCGTAGATTTCGATTTCTGTAAACGCCACGATCCCGGTTTTGTGGGATGGCACAGGAGGAATATGGGTCCGTGGCGCATCACCTCCAGCTTTTAGCTGAGGATTTATATTCTG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 42 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00060761 37
BS00060774 75
BS00060775 91
BS00060776 95
BS00060735 103
BS00060736 108
BS00060737 111
BS00060738 133
BS00060739 146
BS00060740 174
BS00060741 186
BS00060742 192
BS00060743 203
BS00060744 212
BS00060745 249
BS00060746 252
BS00060747 256
BS00060748 257
BS00060749 258
BS00060750 268
BS00060751 283
BS00060752 286
BS00060753 295
BS00060754 296
BS00060755 300
BS00060756 311
BS00060757 317
BS00060758 337
BS00060759 348
BS00060760 349
BS00060762 415
BS00060763 416
BS00060764 421
BS00060765 440
BS00060766 443
BS00060767 466
BS00060768 474
BS00060769 486
BS00060770 507
BS00060771 513
BS00060772 514
BS00060773 557

This contig has been mapped provisionally to chromosome 3DS.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon