Contig Sequence

Contig name: BC000023125 (Nimblegen Contig name: CONTIG96106)

Contains SNP BS00058753 at position 581 (ambiguity code highlighted in red in the sequence below).

CTAGTCAGGACATCAACAATTTTGACGGATCCAGCCATACGGACGGTTAGGGACTCAAGGCATTTGAGCCTGCTCAGGGAACCAGCAAGATCCGCACAATCGCCTTCCCGGACACCTTTATCTAGAATTATCCTCAGGTCCCTCAGATCTCCCAGTTCACCGAGCCCTTTGATGTTCTCCACATCTTGGAGATCTATGCTGAGTTCACCCAGAGTGCGGAGGGCACGCATCCTGCTGATCTCACCAGGCAGCTTCACAGTATATGGAACAATCAGGTGCCACAACGTCGGTGGTAACTTTGTGACATCGAGCTCTAGGTGTAAAAACTCATTTATGTCTTCGCCAACTATCTCCAACGTCTTCAGATGTTGTAATCTTTGCAACTGTCTCTGGAGTTTCTTAAACACAGCGCCTCTGATCCTCAAATACCTCAGTTGGGTAAAGCTGCCTATGGAGGACAGTTCCTCCTCATTTCTGGAGTCATAAACACCAAGATCGAGATGTAGAACTCGCAGGACATGAAATCTCGACAGTGAAGGCATCCATTGAGCAGACCCCCAAAAGTTGAATGATCTGGCCT[R]TGTCAGAGCCATGCTTCCCAGCAACTCATTGTGCTGCGAATTTCTGACTTGTAGGGATAACCTGCGAACCTGCAAACATCCTTTCATGCATTGCGGATCATCAACTGTAGGGGGTCCCTTGATTATATTGATGAAATTTTCTTCCGTGGACTTCCATACGATAAACTCAAGCATTACATCATGCACCCGACAAGATAACACGTGCCCACAATCATCAAACTCTGCAATTTGTATCAT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00058756 82
BS00058757 86
BS00058758 93
BS00058739 120
BS00058740 125
BS00058741 128
BS00058742 133
BS00058743 146
BS00058744 151
BS00058745 167
BS00058746 194
BS00058747 207
BS00058748 227
BS00058749 251
BS00058750 261
BS00058751 464
BS00058752 521
BS00058753 581
BS00058754 585
BS00058755 615

This contig has been mapped provisionally to chromosome 3B-.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon