Contig Sequence

Contig name: BC000022995 (Nimblegen Contig name: CONTIG95577)

Contains SNP BS00058159 at position 549 (ambiguity code highlighted in red in the sequence below).

CGAACGGATGCACAAGAAAATGCAGGCACAGATCAAGTTGTTGAGCTTTATTAGAATAATACATAATGCTAATGGACCACTACATACTAATTAACTTGAAGATTACCAAGCAACTAGCAAGTGACTAACTAAACTACTAACTTGAGTAAGACTGGCTAAAGATACTGGGAAATAATAGTACAAATAAATTAGCAAATCACACAACTAAATCCTACAAGTCCACTTCACAGGCCAACACGTAAAAGATGTAATGTCCGACATACTACATAGAAGGTTAATTTCAATGTCGACCATGTCAGCAGACACAGCAGACAAATACGGTAGAACCTATAACAGATAACCATTTCTGCTTCTCAGCAGCTCAAAGAGAACTCCAGGTACCTGTTGAACTAACATAGCACGTTAGCAGACCTCACGTGTTTACGTTCACAGCTCCAGCATCTCCTCAGGAAACACCCCTGACTGTGGTATAGAAATTTCTATAGGGATAAAATAAGATGTAGCATATGCTATCCATTTTCATAATATTTTTGACTTGCAACGTATCA[R]CATGGAGCATAAATACACCAATCATCGTAGAAAGAACAATCACATTTGTGTCCTCATCATATCCCACCATCAGCACACTGGTGATGTCACTTTGCATTGTGTGTGGAAAGTGCTCCTCCAATTGAATGGTTTTCTGCTGCAACACCCATCCATGGACACCACCTCTGTTCAATTTCCTCTCCCATAGCTTGATGATATGTTTTGCCAGAACAGCGCAACCAAGTCCATTATCCTTTGTCCGTAAGAGCTGGATGATGTAGTACTCCGAAGTAATATGGGGGTCAGCCGGTTTCTTAATCA

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00058152 284
BS00058153 289
BS00058154 501
BS00058155 503
BS00058156 541
BS00058157 542
BS00058158 545
BS00058159 549
BS00058160 563
BS00058161 566
BS00058162 569
BS00058163 616
BS00058164 629
BS00058165 699
BS00058166 702
BS00058167 720
BS00058168 736
BS00058169 804
BS00058170 824
BS00058171 844

This contig has been mapped provisionally to chromosome 6AS.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon