Contig Sequence

Contig name: BC000002156 (Nimblegen Contig name: CONTIG64441)

Contains SNP BS00003917 at position 890 (ambiguity code highlighted in red in the sequence below).

ACATGGTGTACAAGCTCACCCGGGTCTCTCGCCTCCTTGTGGGAGCTGGCGGCGAGAGCTCTCGCCGCCGTGACCTGTCGCCGATGGTGGGTGTGTTTGTCAACCCGGTTGCTATTACTGCTCTCTTTAGCATACACGAGTGGTTCACCGACGAAAAGAGCGCTGCCTCACCGTCACTCTTCGAGGTAGCACATGGCTGTACCCGGTGGGAGATGATAGCAAAGGACGCCAGCGATGACCGTGTGTTCAATGCCGGCATGGCCGCAGACTGCTGCCTCAGTATGGAGATCCTCCTAAGAGAGTGCAATGGCGTCTTCGGATCCCTGGGCAGCTCACTGGTCGATGTTGGTGGTGCCCATGGCGCCGCTACTGCGGTGGTCGCCAAGGCATTTCCACACGTCAAGTGTACCGTGCTGGACCTCCCTCGTGTCATCGCCGGGGCTCCAGTCGATGATAATTTAACCTTCGTCCCCGGTGACATGTTTGAGTACATCCCGCCGGCAGACACCGTTCTTCTCAAGTGGATTTTGCATGATTGGCCAGACGAAGATTGCATCAAGATACTGTGCCAGTGCAAGAAAGCCATCCCGACAAGGGACGCCGGAGGGAAGGTGATAATCATGGATATGGTGGTCGGATCTGCAGGGCCTCAGCAGGAAACCGTGTCGAAGGAGGCGGAGGTTTTGTTCGATGTTTTCATGATGTACATCGACGGGATCCAGCGAGAGGAGCATGAGTGGAGGAAGATTTTCTTTGAAGCGGGGTTCAGCGACTACAAGATTACACCTGTGACCGGAATTCGTTCGATTATTGAAGTCTACCCTTAAATATAAATCTTCATACTTCATGTTATGGATTTGGATGCATTGTTGTATGTAAGTTGTACCTT[Y]ATAATGTTATCATTTTCACTT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 13 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00008004 123
BS00003745 270
BS00022054 270
BS00008005 416
BS00004846 432
BS00003769 476
BS00003868 503
BS00004847 515
BS00006086 545
BS00006085 567
BS00016071 743
BS00005108 761
BS00003917 890 1B 28.77



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.