Contig Sequence

Contig name: BC000019944 (Nimblegen Contig name: CONTIG76849)

Contains SNP BS00046292 at position 94 (ambiguity code highlighted in red in the sequence below).

CCACGCGTCCGATCGCCGTCATTTACAGCTTTATCGACCCATAGCCCATAGGCCATAGCCAATTAGCCATATGGCAACCAAATCGACTCAAAG[M]ACGGGACCTTCATTCTTCAACTTCCTAAAGGAAGGCCTCCTGCTCCCGACCCGCAACCGGAGGCTCTTCTTGGCGGTCTACGCCATCATCATCGCCTCCACCGCGCTGCTCCTCCTCGGCGGCGACCTCGCCGTCCAGCCCCTCGCCGACGAGATCCAGCTCGACGCCAAGGCGCTGAACAGCACCGACCCCGGCAGCCCGGACTTTGCCAAGCTCGTGCAGGAGATCCAGGATGACACCAAGGCGCTCCTGCTCGTGGGCGCGGGGTACCTCCTGCTCGCTGTCGTCGTCAGCTCGGCCGTCCGGATCGTCCTCCTCTTCGCCGCCGTCTCGACGTACTCCGGCGAGGAGCAGCACGCTACCTTGGGGCTTGGGCGCGCTCCTGGGGAAAGCCAAGGCGCAGCTCAAGGGCCCTCTGATCACGCTCGCCTTCGTCTACGTCCTGGAGATCGTCTGCACCGTGCTTCTGGCGTTCGTGGGCGCGCTTCTCGGCGTCCTCATGGTCATGCTGAAGCAGTACTTCGCGGTGCTCCTCCTGGCGTCAATTCTAATCCTCGCTGCGGCCACCGTCTTCCTCGTGTACTTCTCTTTCCTGTGCTCTTTCAGCATCGTCGTGGCGGTGGCCGAGCCCGGCTGCCACGGCGCGGCCGCGTTAGGCAGGGCGTGGAGGCTGGCCAAGGGGAAGAGGAGGCAGGTCGTGCTGTACGTCGCCGTTACCGGTGCCCTGGCCGCCGTCTTATCGCCGGTGCACACGCTCGCGACGACATGCGCGGGTATATAGCGTGGCTGCTTGGGTTGCTCCTAGGTTTTGTGTACGCCGTTCTGATGGCACTCGTGCAGTTGTTCGCCGTCTGCGCCATGACCGCGTTCTACTACGAGCGCAAAGAGAACATCGACAGCCAGCTGGGGGATACTGCATACGCCAAGTT

Note: The ambiguity code M, highlighted in red, translates to A or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 28 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00046291 92
BS00046292 94 1B 33.63
BS00046265 100
BS00046266 106
BS00046267 109
BS00046268 179
BS00046269 182
BS00046270 198
BS00046271 253
BS00046272 256
BS00046273 298
BS00046274 301
BS00046275 321
BS00046276 336
BS00046277 339
BS00046278 363
BS00046279 379
BS00046280 513
BS00046281 564
BS00046282 574
BS00046283 577
BS00046284 584
BS00046285 611
BS00046286 619
BS00046287 642
BS00046288 648
BS00046289 657
BS00046290 722



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon