Contig Sequence

Contig name: BC000019026 (Nimblegen Contig name: CONTIG70433)

Contains SNP BS00043338 at position 154 (ambiguity code highlighted in red in the sequence below).

GTCAGCATCCTCGGGCAGTGCCGCTTCACCGTCTTCGGGCAGCAACTCTACGCCGTCATCGGTCTGGGCGTCCTGGAGCAGCAACTCTACGCCGTCATCGGTCTGGGCGTCCTGGAGCAGCAACTCGACACCGTCATCGGTCTGGGCGTCCTC[R]GGTAGCAACTCTATGCCATCGTCGGTATGGGCGTCCTCGAGCAGCACGTCTACGCTGTCGCCGGTCTCGGCGTCCTCAGGCAACATGTGTCCGCCGTCGGTATCGGCGCCCTCGGGCAGCACCTCTCCGCCATCGGTCTCGGCGTCGTCGGGCAGCACCTCATTGCCGTCTTGGGTCTCAGCGTCCTCGGGCAGTACCTCTTCACCGGCCAAGATGGGCAAGCTCCCTGTACTAAGGACATGCACACCATTGCTTGGGAAGCAGTTGAGCTTGTTGCCGCACATGCATCATGTTCCTGATCTTGGGCAACCGCCAAGGACATGGACGTCGTCTTGAACAAAATTGAGCAGCATGGGCGAGACATCTTCTACACGAACGCA

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 27 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00043337 124
BS00043338 154 2B 100.89 2B 43.36
BS00043339 166
BS00043340 168
BS00043341 172
BS00043342 181
BS00043343 192
BS00043344 193
BS00043345 223
BS00043346 232
BS00043347 254
BS00043348 268
BS00043349 282
BS00043350 286
BS00043351 288
BS00043352 295
BS00043353 320
BS00043354 325
BS00043355 404
BS00043356 419
BS00043357 430
BS00043358 444
BS00043359 446
BS00043360 454
BS00043361 468
BS00043362 527
BS00043363 529



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon