Contig Sequence

Contig name: BC000000438 (Nimblegen Contig name: CONTIG93694)

Contains SNP BS00023118 at position 872 (ambiguity code highlighted in red in the sequence below).

AAACCTTCTCCTCACCCTCCAATGGCGGCCGCGACCTCCTCCTTCGCCACGCTCGCCATCGCCCGCCNNNNNNNNNNNNNNNNNNNNNNNCAGAGGGCGCTCCTCGCCTCGAAGGCCCCCTCGTCGGCGCTCTCCCTCCGCGGCGGCCGCATCGCGTCCCCGGCCCTCTCCGTCTCCCAGCAGAGCCGCGCGCGCTTCGTCCCCTCCGCCACCGCCGAACCCTATGCACCTGAGCTTCAGTCCAAAGTTACAAACAAGGTGTACTTTGACATAAGCATTGGCAACCCTGTCGGGAAGAACGTTGGGAGGATTGTCATCGGGCTGTATGGGGATGATGTTCCCCAAACCGTTGAGAACTTCCGTGCTCTCTGCACTGGGGAGAAAGGGTTCGGATACAAGGGATCAAGTTTCCACCGTGTCATTAAGGACTTCATGATTCAGGGGGGAGACTTTGACAAGGGCAACGGTACTGGAGGGAAAAGCATATATGGCCGCACCTTTAAGGATGAGAACTTCCAATTGGTTCATACTGGACCTGGAGTGCTCAGCATGGCGAATGCTGGACCGAACACCAACGGCAGCCAATTCTTCATCTGCACAGTCAAGACACCGTGGCTGGACGGGAGACACGTTGTCTTTGGCCAGGTTCTTGAAGGCATGGACATCGTAAGGACGATAGAGTCATCAGAGACCGACAGAGGTGACCGTCCGAAGAAGAAGGTGGTCATTAGTGAGTGCGGGGAGCTTCCAGTGGTCTGAGTTTTATTTAGATGGCTATCACCTTCCATCTGCGCATCTTGATTTTGCTGTGGACTTGTTACTTGTCTTTCTCCAAGTAGTTAGAGACCGCACTGAGTTGAACTCGAGATTT[Y]TACTCTGAGGCATACGGCATTCATCAACTGTTCGACTGGAATAAGAATGTGATTGCTTTCCTGAACCTGTTTTGTAGCATTGCTCATGGTAGATAATGCCTTGTGAATTTTTTGGCGGATC

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 20 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00015154 324
BS00004079 555
BS00000742 555 1A 9.36
BS00012608 576
BS00008322 600
BS00000741 601
BS00000740 603
BS00014687 639
BS00008323 663
BS00008324 674
BS00019435 687
BS00004324 729
BS00008325 737
BS00008326 750
BS00008327 775
BS00008328 778
BS00021071 809
BS00023118 872 1A 12.83
BS00020003 877
BS00004323 889



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon