Contig Sequence

Contig name: BC000007281 (Nimblegen Contig name: CONTIG13342)

Contains SNP BS00012592 at position 283 (ambiguity code highlighted in red in the sequence below).

TGTGGTACGGCAAGGCGAGCAGCCAAGAGAAGGCTTCCTACTTCTGTCCAACCTCGTCGAGGATCAGATGGCAGGAACAAGCAGTTACATGGACTGGATACTCCAAATTCACCGCCAAACACAGAGCTCGTGATGATGTATGGTGGATGTTCCAGAAATTTTTGTTTTTGTGTAAACTGCTGCAGATTCGGTTGCTGTGCCAGTCCCCAGTCGCCCTCTTAACCATTGGNNNNNNNTGGCGAGCCAGCCGTGCTCTACCATATGCCATCCTGTTAGCAGCAG[K]GCTCTCGCTGTCGGCGAGCAATACAAACTTTATTGTTAATATATTTCGTTCTTGTGATTATTTTTCGTGACGAGAAAAGGATACAGCTGTTGTATCAGAATAAGTAGGCAGCACCTTTGGTAAATTGTACAATCGTTTGGAGTCTTTGGTAGGGGTTTGTACGCATTTGTATCGTCGACAATTTTTAGTTGCAAAGATTGTGTAAACTCTTGTTCGACTGTTGGTACTGATCTGGATGCAATAGGAAGCACCTTTTTACTC

Note: The ambiguity code K, highlighted in red, translates to G or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 11 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00012574 73
BS00016990 163
BS00017044 171
BS00020659 172
BS00020787 176
BS00012492 192
BS00014810 209
BS00012628 232 2A 16.74
BS00012592 283 2A 14.36
BS00013603 378
BS00013211 416



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon