Contig Sequence

Contig name: BC000006073 (Nimblegen Contig name: CONTIG46351)

Contains SNP BS00009995 at position 215 (ambiguity code highlighted in red in the sequence below).

AGAAGTATCAGTTGTGCAACACAAATCACAAGAGTACACCAGCTTTGAGACAAAGAGGTAGCCCGAATAGAAATGTGGAGCTTTATTTGTTGCCGCATCCAATCAGAGTACGTGACTTGGGCTCCATAACCAAAGGCGCATCTCGGTTTAGGCATCTAGGACTTGACGGCCGGCGTTGTAGCTGAGCATGCCATATCTATTTGCTCGTCTCGTA[M]CAAATGCTGCGGATAAAGTCTTGTCATCTCCAGTATTGGACGGTTGGGGTTCGCCTCGGCCATGCTCTTGAAAGCATCCTCCGCAGCCTCTACTTCTGCCACCATCGAGCGATAGCAGGTAAGCTGACAGTGAGGCGAGCAAGGCTGGAGAGGCGTTGGATGCCAAAGTCGAAATCGACCGCAGCAGATTTGGGCTTTCGATGAAGTTCCGGAGTTAAGCTCCTTGAGCCTCGGCATAGCCCCCGGTTCAAACATTAAAACTCCCATACGAGTACCGTAAACCCAAAACTCTGCAACTGTTGAAATCCTTCACGCCTGATGATGAGCCGCCCAGCGTCGTCTGTT

Note: The ambiguity code M, highlighted in red, translates to A or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 15 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00009995 215 7A 131.97
BS00021230 220
BS00010908 230
BS00011900 232
BS00010968 233
BS00016611 280
BS00009860 335
BS00010205 411 Group 34 16.73
BS00012005 414
BS00009920 415
BS00012769 420
BS00020614 424
BS00017793 425
BS00011422 531
BS00010997 541



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon