Contig Sequence

Contig name: BC000035572 (Nimblegen Contig name: CONTIG78865)

Contains SNP BS00099829 at position 448 (ambiguity code highlighted in red in the sequence below).

CGAGGGGATTCCAGCTTTAAATCAGAATGTCCAGGCCAATGGCGATATCAGTTCATCAACTGTTGAGCTGTCATCATGTACCTCTGGTCAGCCACAATCAGAAACTACAGCAGCACCTTGTGAGGAAAGCGTTTCTTCTCAAACTAAGGTTCATCACCTTCACTGCTTCTTGGAGTTGCAAAAATGGAAGTAGAACCATTGGGAGTGATTGACCATGAAGCGGAAACATCAAAGGTGTCGGAGCATGAAGCACACGTGCTGGAGACTGGCCCATTGGTTGCCATGGACATTGCAGAGGACGAGGGGATTCCAGCTTTAAATCAGAATGTCCAGGCCAATGGCGATATCAGTTCATCAACTGTTGAGCTGTTATCAGGTGCCTCTGGTCAGCCACAATCAGAAACTACAGCAGCACCTTGTGAGGAAAGCGTTTCTTCTCAAACTAAG[K]TATCATCACCTTCACTGCCTCTTGAAGTTGCAAAAATGGAAGTAGAACCATTGGAGGTGATTGAGCATGAAGCTTGGATGCCCCA

Note: The ambiguity code K, highlighted in red, translates to G or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 15 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00099835 61
BS00099836 81
BS00099837 95
BS00099823 111
BS00099824 116
BS00099825 121
BS00099826 127
BS00099827 238
BS00099828 371
BS00099829 448 1B 46.70
BS00099830 467
BS00099831 473
BS00099832 503
BS00099833 504
BS00099834 525



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon