Contig Sequence

Contig name: BC000028270 (Nimblegen Contig name: GJKKTUG01C3LL1)

Contains SNP BS00073763 at position 108 (ambiguity code highlighted in red in the sequence below).

AAGACGAATGGTGGACAAGGATTCACAAATCGGAGCATCGATGTGGGTATTTGGTAGATTGAGAACCTGAAGCTGTGGAGTGGAATTAGCAAAGGCACTGCACCATG[Y]TGCCCCGTTGCCGGACAAGTCGACGTTGCCTAGATAAAGCTCCTTGAGGTTGCTAAGGTTAGCAACGAATGATCCAATATCTGGCTCTACGATGGGCCACCTTCCTTCGCCGAGTGGCAGGAAATAGTCGTTGTCGCCTTCAACAAGATAAATCCAATTGGTGAAATCTAGGGATACCAGCTTCCTGAGCCGCCGTATCCCGTGTGGTATCTTGCCTACCAAGTCGGTGTAGGACAGGTTGAGGTAGGTGAGCTCGGTGAGCCTCTCGAACCCGACGGCCGGGAGCTCGGACTCGTCGAAGC

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 16 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00073776 58
BS00073777 59
BS00073778 73
BS00073763 108
BS00073764 114
BS00073765 136
BS00073766 137
BS00073767 172
BS00073768 187
BS00073769 190
BS00073770 196
BS00073771 265
BS00073772 274
BS00073773 277
BS00073774 281
BS00073775 292

This contig has been mapped provisionally to chromosome 1AL.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon