Contig Sequence

Contig name: BC000025093 (Nimblegen Contig name: F0Z7V0F01EEXSW)

Contains SNP BS00065772 at position 329 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTAAGAGCGAGCAAAACTATGGGTTGAATTTGTTGTGCTAAAGGGACCGACATAATGCATTGTTGAGTTCTGAATTCATCAAGTTTGTGTCAGCTGTGCTGGAAGGTTAGTGTGCAGAATTTGTGAAGTGTTATATACACAAACCAGTACATTCTTCTTTCGGAAGGAGCTGTTTGCTTTGCTGGTGCTAAGGCACTTTGGAATAGCTGGGTGCCATTGAACTGTAATTCATTTGCTTGGCTTCGCAACATCGAGTATGGACATCGGATCGTCGGGTCAGAAGAGAGCTGCAGGTACATATTTGGCC[M]TGCTTTCTTTGAGCAGGAAGAGGACATTGCGACCTCATCCCGCTTCAGTGCGTATATACTCGACAGATATGGTATCGATGTCTTCGATCGACTCATCTTGATGCTGTCCCTGCCCCTTCTGTCATCGATAATATTCCGG

Note: The ambiguity code M, highlighted in red, translates to A or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 23 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00065780 42
BS00065781 62
BS00065782 68
BS00065761 112
BS00065762 122
BS00065763 129
BS00065760 154
BS00065764 154
BS00065765 169
BS00065766 205
BS00065767 213
BS00065768 232
BS00065769 265
BS00065770 299
BS00065771 301
BS00065772 329
BS00065773 338
BS00065774 339
BS00065775 340
BS00065776 359
BS00065777 375
BS00065778 381
BS00065779 396

This contig has been mapped provisionally to chromosome 7AS.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon