Contig Sequence

Contig name: BC000024779 (Nimblegen Contig name: F0Z7V0F01CW4Z8)

Contains SNP BS00064836 at position 157 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTTACGCGGGGAAGAAATAATTTTTAAATTTGTTTTTGTCCATTCTCTCAGCTCACAATGATTTCACTCCTTTTTAGGACTCCAATAGGATTTGCATATACAAATGATAATATACATTTATATTGAACTCATCGC[Y]GCTCTGAACTCATATCTAAACGGATCACAAATACTAGACTTAATGGACTGTTGCAGAATTAACAGAAAACCAGGTACCACCATCACCCTACTAGCGTGCCTGAATCATTCATCATGTTGCACTTTGGAGTCTTAATGGTCTTCTGCTTTAAAATCACCTCTTCCACTCGTTTTCCTGACAAAAACTATTGATTTCTCAAAAGTCTTGTTGTTTCTCTTCCAACCTTTGTACTTCAGAAACCTATGAATTGTATTGATT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 18 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00064826 100
BS00064835 132
BS00064827 135
BS00064822 147
BS00064823 156
BS00064836 157
BS00064839 178
BS00064824 186
BS00064825 197
BS00064828 221
BS00064829 239
BS00064837 276
BS00064830 293
BS00064838 306
BS00064831 308
BS00064832 348
BS00064833 367
BS00064834 378

This contig has been mapped provisionally to chromosome 1BS.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon