Contig Sequence

Contig name: BC000024568 (Nimblegen Contig name: F0Z7V0F01BXAAG)

Contains SNP BS00064052 at position 112 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTGGCCGCCTCGGCCGGGCATAATCGATCAATAGGACTGAAGGGGCGCAGCAAGCCTGGGGCGCTGGAAAATGAAGAAACGCCTGGCACC[R]TATCAACAGCAACATATGAAGCTCTATCTTTGCTCTGAACTTTAATCCTACCCTGGCAGGACAGGAGGATGGCATCCATCTCTTTATCCTGTTATATCCTGTGGAGGAACCCATATGGTTTTGTAACAGTATACTGTATCAGGTTGTGGAAAAATGCTCGTGGGCGAAGGTTTTTCTTGTGTTATGCGGCGTCGTAAACGAGTAACAGCGGATAGCAATGCTGTATTCAGTGTGAGGAATGTGGCAGCAACAAGAATGCGGTCAGTGTGAAAAAGGGTGGTGGCCAAAATGGGTTCAGCACCATTGNNNNNNNNCTTTCTAGACTAGAGTATACATACATAAAGGTNNNNNNNNNNNNNNNNNGTAACTAACTAGCGTT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 22 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00064051 56
BS00064070 67
BS00064071 72
BS00064052 112
BS00064067 121
BS00064054 132
BS00064068 138
BS00064062 147
BS00064055 150
BS00064056 157
BS00064057 177
BS00064069 222
BS00064053 239
BS00064063 259
BS00064058 276
BS00064059 306
BS00064060 310
BS00064061 333
BS00064064 343
BS00064065 344
BS00064066 362
BS00064050 373

This contig has been mapped provisionally to chromosome 2AL.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon