Contig Sequence

Contig name: BC000024308 (Nimblegen Contig name: F0Z7V0F01AUCJ7)

Contains SNP BS00063208 at position 338 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTCGCTTGCATTATGCAAATATTACTCAGAGAAATACCGGTATTAAGACAGTAGTTTACGTTCTCGAGGACTATGACAGAAGAGAATGGGTACTGAAGCATACCGTTAAACTTTCAGACATGTTTGATAGCAAAGACTACGGGATTGGCTTTGATTGGGTTGCGATCCATCCAGAATGTAACGTGATCTTCTTCACCCTGTGGTCAGGAAATCAGTTCATGTGTTACAACATGGATACTGGGCGAACTAGCCAGATCCGCACTCTTGAAGATGGCCGGTCACCGTATCTGTCATATGTGCCGTTCTACTCAGAGTT[R]CAATGTTTGCGCTCGTGACATCAATGCATCAATGCGGGGCTGCTGGTGTCTTTATGAGTTTGATCTTTGAAAGGAGACAATTGTCCGTGCTTTGGAGCAATGTGCTTGGTGTGTCTG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 22 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00063211 75
BS00063212 92
BS00063191 125
BS00063192 148
BS00063193 159
BS00063194 167
BS00063195 170
BS00063196 199
BS00063197 204
BS00063198 219
BS00063199 233
BS00063200 239
BS00063201 264
BS00063202 297
BS00063203 305
BS00063204 312
BS00063205 314
BS00063206 323
BS00063207 336
BS00063208 338
BS00063209 348
BS00063210 361

This contig has been mapped provisionally to chromosome 7BL.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon