Contig Sequence

Contig name: BC000023121 (Nimblegen Contig name: CONTIG96087)

Contains SNP BS00058711 at position 181 (ambiguity code highlighted in red in the sequence below).

ACTCAAGGATGNAGTTTTAAGGATTGAGACCGATATCATGGGTGCAGTTTCCAGAGCTGGGTCTAGTAAAGATAACGAGCTTCCGAAGGTTTTATCCGATGTTTCACCAAGGAATATCGAGAATATTAGCAAGCATTTGAATACTAAGGATACAGAGATTGCTAGGCTGAGAGATGAAAT[Y]AGGATATTATCTGCTCATTGGACAAACAAAACAAAGGAACTAGAGTCGCAACTAGAGAAGCAGCGAAGAACAGACCAGGAGCTGAAAAAGAGGGTTCTAAAACTTGAATTCTGCCTTCAAGAATCACGTTCTCAAATCAGAAAACTTCAGAGGTTGGGGGAGAAGAGGGACAAGCAGCTCAAAGGAGCTCAAGGATCAGATGGCCATGAAGCAGCCCAAGGGCCCTCGCCGTGACGAAGGCAAGAAGCCCTTCTGGGAGAATGATACGTTCAAGTTCGTCGCCGGCATGTCAATGCTGGTCGTGATGGTCCTCGCAAAGCGTTGAGAACAGCGTGATCTTGTGTAGAGAAGTTGGAGACTCTAGACTTTAGGTGAGCAACTAGCTCGCTCTGTAGTTTTAAGAAGCCAGCCATGTACTGGAGTAGCGTTGTAAAATTAGGTTTAGGCCTGGACATGCTGCATGGTCAGATGTTCAGAGACCAGAATTCGTCGACATCCAGGTTTAGTCCTCTAGACCGTAGCAGTGTAGCTCAGCTGCTAGTTCATGTATGGTAGTTAACTGTAATCCTGTACTTTATGATGTTTAGTACTCTTAAGCATCTATTCTTCTAATATAAGACATTTGGTACTCT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 13 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00058713 34
BS00058722 94
BS00058710 163
BS00058711 181
BS00058712 195
BS00058714 412
BS00058715 413
BS00058716 424
BS00058717 446
BS00058718 503
BS00058719 516
BS00058720 633
BS00058721 676

This contig has been mapped provisionally to chromosome 1DS.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon