CerealsDB

CerealsDB web API

An application programming interface (API) is a set of routines, protocols, and tools for building software applications. A web API is a subset of web services that use REST conventions. This page describes those protocols that will allow bioinformaticians to develop software applications that can extract data from CerealsDB.

For the API we adopted a JSON-based schema for messaging between the CerealsDB server and Clients. JSON (or JavaScript Object Notation) is a lightweight text-based open standard designed for human-readable data interchange.

The available web services can be accessed by sending a JSON request to CerealsDB (via curl or a perl script for example). The JSON request is:

{ "operations": { "operation_id": 0 } }

This will return a JSON response containing a list of the services that the CerealsDB site provides, for example:

{ "schema_version": 0.1, "provider": { "name": "CerealsDB", "description": "A service to give information about SNP markers; e.g., the sequence upon which they are based, obtain primers used for their identification, identify the haplotypes of common UK varieties.", "url": "https://www.cerealsdb.uk.net/cerealgenomics/cgi-bin/parse_json_v3.cgi" }, "services": { "path": "Contig service", "summary": "A service to obtain contig information", "description": "A service to obtain contig information using SNP names, contig names or generic search terms", "operations": [ { "operationId": "Contigservice", "summary": "An operation to obtain contig information using SNP or Contig names", "description": "An operation to obtain contig information using SNP or Contig names", "parameter_set": { "parameters": [ { "param": "SNP_id", "name": "SNP id", "default": "BS00003643", "current_value": "BS00003643", "type": "string", "tag": 1, "wheatis_type": 11, "description": "The SNP name (a 10 character alphanumeric beginning with 'BS' or 'BA'; e.g., BS00010624 or BA0033400) to find the contig to which it maps and all other putative SNPs, validated or not, that have been mapped to it. SNP names (IDs) may take different forms depending on the platform on which the assay was developed" }, { "param": "contig_name", "name": "Contig name", "default": "", "current_value": "", "type": "string", "tag": 2, "wheatis_type": 11, "description": "The contig name (e.g. BC000000280)" } ] } }, { "operationId": "Search service", "summary": "An operation to obtain contig information using generic search terms", "description": "An operation to obtain contig information generic search terms", "parameter_set": { "parameters": [ { "param": "Search_term", "name": "Search term", "default": "", "current_value": "", "type": "string", "tag": 3, "wheatis_type": 11, "description": "Any keywords (e.g., 'disease', 'cold') " } ] } } ] } }

This in turn allows the client to parse this information and construct a JSON query that requests data from CerealsDB, for example:

{ "services": [{ "service": "Contigservice", "run": true, "parameter_set": { "parameters": [{ "param": "contig_name", "current_value": "BC000000118", "tag": 2, "type": "string", "wheatis_type": 11, "level": 7, "concise": true }, { "param": "SNP_id", "current_value": "BS00003644", "tag": 1, "type": "string", "wheatis_type": 11, "level": 7, "concise": true }] } }, { "run": true, "services": "Searchservice", "parameter_set": { "parameters": [{ "param": "Search_term", "current_value": "rht", "tag": 3 }] } }] }

In the above JSON code we have requested both the "Contig" and the "Search" web services (set to true). For the contig service we have requested information on a contig called BC000000118 and a SNP called BS00003644. We have also requested information from the Search web service which takes a search term (such as "rht" in this example) and the web service will return a list of contigs that have been annotated with this term. The resulting JSON code can then be parsed, so that the extracted data can be used in subsequent applications.

An example of this JSON response is shown below, and we can see that the web services have returned information on contig BC000000118, including the sequence of this contig and any SNPs (and their position) in the contig. We also have information on the SNP we requested (BS00003644) and we have obtained the sequence of the contig that surrounds the SNP as well as it's position in the sequence. Finally we have a contigs that has been annotated with the search term "rht". The top BLAST hits for this contig have been concatenated together to increase the chance of identifying interesting annotations.

{ "service": "Foobar Keyword Contig service", "status": "3", "description": "An operation to obtain contig information using SNP or Contig names", "uri": "https://www.cerealsdb.uk.net/cerealgenomics/cgi-bin/parse_json_v3.cgi", "results": [{ "protocol": "inline", "title": "BC000000118", "data": { "format": "CONTIG", "contains": [{ "id": "BS00000209", "data": "GGGCTGCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGCCATGGAGTCGGCCTAGCCAGTTGTGCCCGTTGAGAGCGCTCATATACCCTCAGAGACGGACCTCCAGATCTGTGGTCTGTTGTAGTCTCTCTGCTTCCTCAAAACAAGCCCCTGCAGCCGCGCCCGGATCGGATGGACACYGCCATGCACCCCGCCGGCGGCCTCGCCGACCTGCTTACCGACAACGCCGGCACCGGCACCGGCACCGAGGGCATTATTTGTGGCATGCCAGACTTCAAGATGGGTGGAAAGAGGGGCGATGAATCTGCCCCTACTGATGCTGGTGATGAAGATGGCGAAGATGATGACGGGGATGAGGATGGTGACTTCGCGGAGGGCGAAGAGGAAATCTCGGAAGGAGAGGAGTATGACAACCCCAAGGCCAGTGACGCCAAGAAGAAACAAATAGGCGAGGGTGAGGAGAATGGCGAGGATGATGAGGAAGAACAAGAGGAGCAGGACGGTGGAGGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTAGAAGAGGAGGATGACGACCAGGACAACGACGATGATGAGGAGGACGATGACGA", "position": 282 }], "putative": [{ "id": "BS00000211", "position": 204 }, { "id": "BS00000210", "position": 240 }, { "id": "BS00000209", "position": 282 }] }, "protocol": "inline", "title": "BS00003644", "data": { "format": "SNP", "contains": [{ "id": "BS00003644", "data": "CCTCCACNTACGACGGCAACGGCTCCACCGGCGTCTCAGCGAAGCAGAGCGGCTACCTGAATTTCCAGTACAGGGAGTGGGACTCGCCCTATGAGAGGGTGCCGCTGGCTCACAAGGTGGCGGAGCTGGCTCAGGATTACCCATGCCTCTTGTCGCTTAGCAGCGCGGAGCTCTCCCCGTCCAGCTGGATGTCCGTGGCATGGTACCCAATCTATCACATCCCTGCTCATGTCAACCTGAAGGGTACCTCTGCCTGCTTTCTCACCTAYCATTCCATCTCATCAGTCTTCCAAGACAACATACATAGCGGGCCGGAACACGGTGAGGGTGAGATCGCGGCGCTCTCGCCGTTTGGGTTGGCAACCTACAGGATGCAAGGGGACCTGTGGAAGAGACCAGGGTCATCAGACTATAGGAGGTTGTCTGAGCTCCACTGGGCGGCGGCCTCCTGGTTGAAGCAAGTTGGTGCTCACCACCCCGACTTCACCTTCTTCACATCTTCTCACCGTCGATAACACGGCACCCGGTCGATTCCTCAT", "position": 269 }], "putative": [{ "id": "BS00003644", "position": 269 }] }, "protocol": "inline", "title": "BC000019180", "data": { "format": "BLAST_RESULT", "contains": [{ "id": "BC000019180", "data": "|nuclear transcription factor SLN1 [Hordeum vulgare subsp. vulgare]|RecName: Full=DELLA protein SLN1; AltName: Full=Slender protein 1|RecName: Full=DELLA protein RHT-1; AltName: Full=Protein Rht-B1/Rht-D1; AltName: Full=Reduced height protein 1|predicted protein [Hordeum vulgare subsp. vulgare]|gibberellic acid-insensitive [Saccharum hybrid cultivar Co 419]|truncated gibberellic acid-insensitive isoform 1 [Saccharum hybrid cultivar Co 419]|truncated gibberellic acid-insensitive isoform 2 [Saccharum hybrid cultivar Co 419]|truncated gibberellic acid-insensitive isoform 3 [Saccharum hybrid cultivar Co 419]|OsGAI [Oryza sativa Japonica Group]|DELLA protein [Oryza sativa Japonica Group]|Os03g0707600 [Oryza sativa Japonica Group]|gibberellic acid-insensitive [Oryza sativa Indica Group]|gibberellin-insensitive protein OsGAI [Oryza sativa Japonica Group]|Os03g0707600 [Oryza sativa Japonica Group]|RecName: Full=DELLA protein SLR1; AltName: Full=Gibberellic acid-insensitive mutant protein; AltName: Full=OsGAI; AltName: Full=Protein SLENDER RICE1|hypothetical protein OsI_13213 [Oryza sativa Indica Group]|hypothetical protein OsJ_12286 [Oryza sativa Japonica Group]|gibberellin response modulator" }] } }] }

---

Based at the University of Bristol with support from BBSRC.

Maintained by Mark Winfield.