CerealsDB

Breeders' 35K Axiom SNP Summary Information

Summary information for the SNP is listed below:

Map location in various crosses

Avalon X Cadenza	Not mapped in this cross
Savannah X Rialto	Not mapped in this cross
Synthetic X Opata	Not mapped in this cross
IWGSC physical	2BL
iSelect Consensus

Sequence

CTCCACGACGGTGTGATGGATCTGGACGATGCTTT[C/G]GGGCACAGAGCTAGGTTCTCAAATAGGATTCACCG

---

BLAST sequence

To BLAST the above sequence against our SNP database click on the 'Queryi SNP databse' button below. You may select an e-value cut-off for this search.

e-value cutoff  10 1 0.1 0.01 0.001 0.0001 e-5 e-10 e-20 e-50 e-100 e-150 e-250

Alternatively, you may perform a BLASTN against Brachypodium, Rice or Rye sequences. Use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters

Database:  Brachypodia distachyon Oryza sativa Rye Rye singletons (raw data)

e-value cutoff:  10 1 0.1 0.01 0.001 0.0001 e-5 e-10 e-20 e-50 e-100 e-150 e-250

---

Based at the University of Bristol with support from BBSRC.