Flowering time markers

These flowering time markers were provided by Simon Griffiths at the John Innes Centre and were developed as part of the ADAPTAWHEAT project.

For more information on these markers see the embedded .pdf file at the bottom of this page.

Markers

Marker nameAssay typeGene/LocusChrMutationPhenotype+ve ControlsSensitive/-ve controlsAdittional infoReference
TaBradi2g14790KASPEPS-D11DDeletionEarlier flowering under long daysSpark / CadenzaWeebil, Rialto, Savanah, Paragon, Charger, Buster and AvalonLinked with 1DL deletion but recombination possible
TaELF3-1D-Kasp1KASPTa-ELF31DSNPEarlier flowering under long daysSavannahRialtoZikhali et al., 2014, 2015
TaFT3-B1-Kasp1KASPPpdB-2/Ta-FT3-1B1BSNP or deletionShort day specific effect (Spark x Rialto) / EPS effect (Avalon x Cadenza and Charger x Badger)Spark (SNP), Avalon and Charger (deletion)Rialto (SNP),Cadenza and Badger
TaTOE1-B1_KASP1KASPPpd-B3/TOE11BSNPSee document for TOE1 gene structure and haplotypes

Copy Number Assay Primers

CallNameSequence
FT3BWhtFT3BFGATCCATTTACATCAACTGTTCCG
WhtFT3BRtagaagcttaccagggtatagagg
WhtFT3PFAM-TGGCAGGTGCTGAGCTAAGACCATCTG-TAMRA
FT3DWhtFT3DFCACTCAGGATAGCCTACAACAAC
WhtFT3DRgccaccgatatcaactcgc
WhtFT3PFAM-TGGCAGGTGCTGAGCTAAGACCATCTG-TAMRA
FT4AWhtFT4afGGAAAGCGCACGCTTAACC
WhtFT4argtcccccgccccag
WhtFT4PFAM-TGCCATACGAGAGCCCAAGCCC-TAMRA
FT4BWhtFT4bfCGCTTAACTTATCTGAATTCCCTTG
WhtFT4brcgtcccccgccccaa
WhtFT4PFAM-TGCCATACGAGAGCCCAAGCCC-TAMRA
FT4DWhtFT4dfGAAAGCGCACGCTTAACAG
WhtFT4drgtcccccgccccag
WhtFT4PFAM-TGCCATACGAGAGCCCAAGCCC-TAMRA
FT5AWhtFT5AFTGTTAACTTGGTTGAATTTCTCTTTCAA
WhtFT5ARcgagtgcaagtactcccttaga
WhtFT5PFAM-AGATGCCCCAAGCCCAAGTCACC-TAMRA
FT5BWhtFT5BFTGGTTGAATTTCTCTTTCACTTGG
WhtFT5BRgtagggagtcatattgacgagaataaa
WhtFT5PFAM-AGATGCCCCAAGCCCAAGTCACC-TAMRA
FT5DWhtFT5DFGAGTTTCTCTTTGACTTAAAAAGATGC
WhtFT5DRcgagaatatgaacatgttgcatctaa
WhtFT5PFAM-AGATGCCCCAAGCCCAAGTCACC-TAMRA
Ppd-B1Ppd-B1FGCGTAAGTTACTATCTCTCATGGTGTATC
Ppd-B1Rtttgttttagtacccagtaccataccag
Ppd-B1PFAM-CTGCTGCTTCAGTTCCTAGTTTCACTTGTGTCC-TAMRA
Vrn-A1Vrn-A1FGCAGCCCACTTTTGGTCTCTA
Vrn-A1Rtctgccctctcgcctgtt
Vrn-A1PFAM-TGTGTTCGCTTTGGTTGTGCAGCA-TAMRA
TaCO2TaCO2FTGCTAACCGTGTGGCATCAC
TaCO2Rggtacatagtgctgctgcatctg
TaCO2PVIC-CATGAGCGTGTGCGTGTCTGCG-TAMRA

Eps-D1 and TaELF3 KASP

TaBradi2g14790Sequence
casTaBradi2g14790_KASP1_FgaaggtgaccaagttcatgctCCTTGTCTCCGTCCCTGSpark allele
casTaBradi2g14790_KASP1_VgaaggtcggagtcaacggattGACAGCTCCTCCCGAGRialto allele
casTaBradi2g14790_KASP1_CTCGGTAATGTCTTCAGTGTTTTA

TaELF3 1D KASP1Sequence
TaELF3 1D Kasp1_F              gaaggtgaccaagttcatgctTGGAGACATGACGGGAACASavannah
TaELF3 1D Kasp1_V              gaaggtcggagtcaacggattTGGAGACATGACGGGAACGRialto
TaELF3 1D Kasp1_C              GGAAACCAGGCTTCACG

TaFT3-B1 KASP

TaFT3-B1Sequence
TaFT3-B1 Kasp1-F              gaaggtgaccaagttcatgctAACAACTAGTGGCAGCTTCA
TaFT3-B1 Kasp1-V              gaaggtcggagtcaacggattACAACTAGTGGCAGCTTCG
TaFT3-B1 Kasp1-C              GGAAACCAGGCTTCACG

TOE1 KASP assays

PrimerSequence
TaTOE1-B1_KASP1_FgaaggtgaccaagttcatgctCTCCACCTCCGCCGA
TaTOE1-B1_KASP1_VgaaggtcggagtcaacggattCTCCACCTCCGCCGC
TaTOE1-B1_KASP1_CCGGGGAACAGCTCTTGG

PrimerSequence
TaTOE1-B1_KASP2_FgaaggtgaccaagttcatgctGCTGAAGGTAACAACACGATG
TaTOE1-B1_KASP2_VgaaggtcggagtcaacggattTGCTGAAGGTAACAACATGATG
TaTOE1-B1_KASP2_CGCCAAATCACAGATGCAA

Additional information





Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->