Contig Sequence

Contig name: BC000036777 (Nimblegen Contig name: CONTIG93819)

Contains SNP BS00106888 at position 283 (ambiguity code highlighted in red in the sequence below).

GGTGAAGNAGCTGAAGCTGCTGGGGTGGTGGGCGCCCGGGGTGAGCCCCTTCGTGCTCCGCGCCCAGATGGCGCTCGCCGTAAAGGGGCTGAGCTACGAGTACCTCCCGGAGGACCGCGGGTGCAAGAGCGACCTCCTCATCGCGTCCAACCCCGTGTACAAGAAGGTGCCCGTCCTCATCCACGACGGCAGGCCCGTCTGCGAGTCGCTGCTCATCCTGGAGTACCTCGACGACGCACCCGGCCTTGCCGGCAACGGCACGTCGATCCTCCCCACAGACCC[S]TACAGCCGCGCCGTCGCTCGCTTCTGGGCCGCCTATGTGAACGGCAAGTTGTTTCCTTCGTGCATCGGCATCCTCAAGACAGCGAAGCAGGAGGAGAGAGCCGGTAAGGTGGAGGAGACCCTGTCCGGGCTCCGACACTTGGAAGGTGTCCTTGCAGAGTGCTCCAAAGGGGAGGCAGAGGCGGAGGCGCCGTTCTTCGGTGGTGACACCATCGGGTTCCTCGACATCGCGCTCGGGTGCTATCTTCCCTGGTTTGAGGCAGTAGGCCGCCTGGCCGGCTTGGGGCCCTCATCGACCCGGCGAGGACGCCGAAACTAGCCGCATGGGCGGAGAGGTTCAGGGTCGCGGAGCCGGTCAAGGCGCTGCTGCCTGGGGTGGACGAGCTGGAGGAGTACATCACTACGGTGCTTTATCCAAAGTGGAACATCGCCGTCACCGGTAACTAGTTAATGATCGTGTCTTTCCATTACCGGCGGAGGATCGTGTCGATCCAATAATTCCTCTGCCTTCTTAGTTGTTTTCACCCCAAGAGTTGAACTGTTGTTACTAGTAGGTCCTTAGTGTCTCCTCCTCGTCGATGGCACGCAGGCGTGCACTCTCTTCGATCTGAGTTGTTGACATGTTGTTTCGTGAATAAATTGAAGCTTCATCCACAGAAAACATTACAAA

Note: The ambiguity code S, highlighted in red, translates to G or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 11 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00106889 64
BS00106894 73
BS00106885 145
BS00106886 218
BS00106887 275
BS00106888 283 4A 126.50
BS00106890 657
BS00106891 686
BS00106892 699
BS00106893 714
BS00106895 734



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

-->