Contig Sequence

Contig name: BC000024200 (Nimblegen Contig name: F0Z7V0F01AFGYN)

Contains SNP BS00062859 at position 92 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTGGACAAATCCTCGAGAGGATCCTCGAGCATAAGTATGAGCATCGGTTCGGGACCTGGTCACTTCGTCA[S]CCTGTTTTGACGTCTGTCACATACCACGATGGTAAGATCCTGGTCGTCATGAAGGATGACCAACCGTGGCGCCTCGCCACACCAAACTGCAATATCACCTGCGATGAGCTTGTCAAGAGCCAGGGGCCGCCGGCGGTGCAGGTGTGGTTTGGCGAATCCACCTGCAATTACAGCTACGTCCTTGACGT

Note: The ambiguity code S, highlighted in red, translates to G or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 15 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00062863 72
BS00062859 92 3B 234.44
BS00062864 103 2D 96.06
BS00062865 111 2D 96.06
BS00062866 134
BS00062867 154
BS00062868 162
BS00062869 213
BS00062858 257
BS00062860 314 7D2 3.97
BS00062861 317
BS00062870 345
BS00062871 368
BS00062862 401
BS00062872 421



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

-->