Contig Sequence

Contig name: BC000005939 (Nimblegen Contig name: CONTIG98274)

Contains SNP BS00009639 at position 523 (ambiguity code highlighted in red in the sequence below).

TTTTCGGGGGTAAGTAGCAAGCTCGCTCACTCCTCGGTCCCTAGTCTGGCAAGAGAGAAGAGAGATGGCTCGCCCCTACCACCTGCCCCTCCTCTCCGTCTTGTCCTTCCTGCTCCTCACCGGCCTTGTGACTGCTGATCTGTCTGGAGGGAATAAAGTCGGGAAGATTGTGACCATGACCGTCCAGTACCCGGCCGCGGGCTCGCCTCCGGGGGAGAAGACCACGATCTCAGCGCACTACGTTGATGAGCACGGGGGCGGCGACCGCCGCTTCGACCTCGACTGTGACGACGACGAGCCCCTCGGTTTCGCCGTGAAGTACCTTATCACGACCCTGGAGGGGATACGAGATGCGCGGGAGTCTCGATCCGAGCTCTAGTACTACCTGGACCTTCACATACGTACGGTGCTCAGCATGGTGGATGGTTGCATGTCCAGTACCCAGTGGAGTAGGCGCCTTTTACTTTGTGCTGTAGTATCAGACTATCAGTAAGGGAAAATTTCTGGCTGTACTTCCATATT[R]TTGTACCCTCTATCAGTAACCAGTGCCAGTCGGAGAGGTAGCAGTGTGGTATAGTACAGTGTGAAACTCTTCTATTCTATGGTGTGGTATCAAGTATCTCTGTAGTATATCTTGGATTGTGTGTGTCGCTTAGCATAAGAGAAGATCGTGTGAAACTCTTATGAGTTCGTTCGAGAAAGAAAATTGTATTCTTATGTCTTCTATT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 13 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00016267 103
BS00014069 198
BS00014244 251
BS00009831 353
BS00011760 353
BS00009639 523 1D 46.79
BS00011059 585
BS00012524 587
BS00012915 601
BS00013513 666
BS00015110 678
BS00013066 684
BS00016941 702



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

-->