Contig Sequence

Contig name: BC000005722 (Nimblegen Contig name: NO NIMBLEGEN CONTIG)

Contains SNP BS00009337 at position 78 (ambiguity code highlighted in red in the sequence below).

GCCACGAGCTGCTTCCATGCTCAAGAACACAGTGGATGCATGCTGATCCACGGAGAGAGCAATTTTCTAGCAATCCT[R]ATCTATTCTCATGTGATCTAGGGGGCAACATTGACAATGTAGTAGATGGGAAGGAGAAAGGATGTAGCCGGAAAGATATTTTGGCGATTATCTGTTGTTACACAAG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 2 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00019023 5
BS00009337 78 3B 141.79



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

-->