Contig Sequence

Contig name: BC000002385 (Nimblegen Contig name: NO NIMBLEGEN CONTIG)

Contains SNP BS00004074 at position 691 (ambiguity code highlighted in red in the sequence below).

GTTCTATAGAAGTCCCTGTCCGCGAAGTTGCTGCTTTGAAGATTTCTGACAACTAGCCAC[S]TATGTGCCCAACCAAGTTGCTCCCAGAAGATGAAAATCAAGATTTTCATGGAGGGCCCT

Note: The ambiguity code S, highlighted in red, translates to G or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 19 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00021179 5
BS00014458 91
BS00017329 92
BS00019046 301
BS00012598 304
BS00019829 336
BS00013024 435
BS00020052 436
BS00017218 492
BS00017898 494
BS00013418 618
BS00004074 691 3B 65.12
BS00014622 722
BS00015976 773
BS00009942 908
BS00011090 911
BS00010102 912
BS00017302 915
BS00021488 916



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

-->