Contig Sequence

Contig name: BC000037516 (Nimblegen Contig name: FZU8VVO01A144I)

Contains SNP BS00110353 at position 137 (ambiguity code highlighted in red in the sequence below).

AAGCAGTGGTATCAACGCAGAGTACCGGGGGAAGCAACAACCTCAAGTAGTAGGCTGGCAGTTCTTCTCTTCCCATTGAACCATCTATACACGGGAGAGAAATCATCCTAACTAGCTAGCTTGGTAGAACTATCTC[R]TTGTGATCTCCTCATCAACTCCAAAGGTAGTTAAGATCTTGCTATGGGTGGTCTCTCTCTTCAGCACCCGTGGGCCTTTGCCTTTGGCCTCCTAGGCAACGTCATCTCGTTCATGACCTACCTGGCCCCACTGCCGACATTCTACCGGATCTACCGGAGCAAGTCGACGCAGGGGTTCCAGTCGGTCCCTTACGTGGTGGCGCTCTTCAGCGCGATGTTGTGGATCTACTACGCGCTGCTCAAGTCTGACGAGTGCCTCCTCATCACCATCAACTCCGCCGGCTGTGTCATTGAGACCATTCACATCATCATCCTACCTC

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 28 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00110348 95
BS00110349 123
BS00110330 135
BS00110352 136
BS00110353 137
BS00110331 144
BS00110332 159
BS00110346 182
BS00110333 187
BS00110334 188
BS00110335 189
BS00110336 192
BS00110350 213
BS00110337 216
BS00110338 218
BS00110351 237
BS00110347 249
BS00110339 254
BS00110340 294
BS00110341 295
BS00110342 298
BS00110343 314
BS00110354 330
BS00110344 348
BS00110355 351
BS00110345 381
BS00110356 387
BS00110357 417

This contig has been mapped provisionally to chromosome 6AS.



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.