Contig Sequence

Contig name: BC000012574 (Nimblegen Contig name: CONTIG101172)

Contains SNP BS00025278 at position 306 (ambiguity code highlighted in red in the sequence below).

TCGGCCAGACCTCGCACGAGACCACCGGCGGAGGCTCAGAAGGGGGATACAAGTTCATAGAGGAGATAAACAAGAACGATCCACTCTACTACGGACGGGGACCGATTCAGTTGACAGGGCAGTCCAACTACAGGGCCGCCGGGGCCGCGCTGAACCAGCCCCTGGAGAGCAACCCGGAGATAGTGGCCAATAACCCGGTGGTCTCCTTCCAGACGGCCCTCTGGTACTGGATGACGGAGCAGTCGCCCAAGCCGTCCTGCCACAACGTCATCCTGGGCAACTGGAAGCCCACGGACGCCGACAAC[R]CCGCCGGCCGGCTGCCCGGCTACGGCGTCATCACAAACATCATCAACGGCGGGGTCGAGTGCGGCATGGGCCAGATGCCAAACGACCCCAACGCGGACCGCATCGCCTACTACAAGCGCTACTGCGACATGCTCAACACCACCTACGGCGACAACCTTGACTGCTACTCCCAGAAGAATTTCGCTGCCTAGTTTTACTATTGAGCTTAGCTTACCACAGCGCAGTGTACGCAACTAAATTCTATGTCTATCCATTATGAATAATAAGTGGCATACGCCATCGTGGAATAAAGATCCATCGGTACGGTTGCGCAGT

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 22 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped, the corresponding fields in the table are left blank and, if available, a putaive location for the contig, based on our extensive NGS of various wheat lines, is given below the table.

SNPs id Position Map Location AxC cM Map Location SxR cM
BS00025289 75
BS00025290 76
BS00025269 145
BS00025270 191
BS00025271 226
BS00025272 238
BS00025273 243
BS00025274 275
BS00025275 286
BS00025276 303
BS00025277 304
BS00025278 306
BS00025279 321
BS00025280 441
BS00025281 506
BS00025282 507
BS00025283 531
BS00025284 535
BS00025285 536
BS00025286 540
BS00025287 558
BS00025288 581

This contig has been mapped provisionally to chromosome 7DL.




BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 








Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon