Contig Sequence

Contig name: BC000012217 (Nimblegen Contig name: CONTIG08835)

Contains SNP BS00024007 at position 177 (ambiguity code highlighted in red in the sequence below).

TGCGCATGATGTGGACATCACAGGCCCATTTGGGGAATCCATCTCTGACGCTGAACATCAGCAGCGCACTATGACCCTTGAAGATTTCTTAAAATCGTGTTACTCAGATCATTCAGCTAATCAAGTTGGAAATGGTGGATCTTTATCAAGTGAATATATTGTTCAATCACTCATGA[K]GGAAAATGGGAGCAACAGCATAAATCTTAATGTTGCACAAGTCCAAGAGCAAGATTTTGACATCACAGTCCCAGTTGGCGATTGCATTTCCCAGGATAATCCTTTGAAGCTTCCTTGTTATCATGCAGATGTGGATAACTCCTTTTGTTCCAAGACTTCTACTGGTGTTCCTGAATGTGTAGTCTCACCTAAATTTCCCAGTACTGAAAAAGACACCCTTGCACCTGCGCTGGATTTTCCTATTCCAGACACCCAAGAATCCTTTGTTGGTTCTGGTGGAGTCTTAGTACAAATGGATAACAATTGTGCTGATGTTGATTACAACTCTGAGGATAGAGTTGAGCATGGTGACACATTCTTGTCTTCTTCAAGTGAGTTGCTTCCTGATTTGAATTCGAATCACTTTGCCTCCATGGCTTCAACTCATTCAAGCTACTCTGTTAGTATTGAGTCACTTGCGGA

Note: The ambiguity code K, highlighted in red, translates to G or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 10 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00024006 139 1B 77.76
BS00024007 177 3A 91.12
BS00024008 179
BS00024009 191 7B 18.01
BS00024010 296 1B 88.49
BS00024011 341 1B 88.49
BS00024012 490 5A 92.08
BS00024013 505 2A 124.54
BS00024014 557 4D 11.40
BS00024015 559 4D 11.40



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->