Contig Sequence

Contig name: BC000005689 (Nimblegen Contig name: NO NIMBLEGEN CONTIG)

Contains SNP BS00010592 at position 410 (ambiguity code highlighted in red in the sequence below).

TTTTTTTTTTTTTTTTTTGATTAAATAGCATTCACCAATCAAATTAAACGGTACTGCCCACATTATTACAGATCAGAAATAGTACTGAATAGTATACAGAATTCTCTCACACTCACTCACAAATAGTCATATGAAACACTAGTCGGCCATACACGTCTGGTGCACATTGAAAATCACAGTGCACAATAAAACAAGCACATGGAAAGTAAGAACAAATCCTGATGGCTCCACATTCCTAGCCAACCTTCTCTTCTTTCTTCTCTTTTTTTGCGGGAAAATCTAACTAGAATTTTCTTCTGAGGATGCTGGGTCTTCAAATCTTTGGTCGGGGATGTGCTTGATCTTCTGCCAATTTGGATGTCTGACTGTTTGACACGACTTCGTGAACTCACCACTGCAGTATGCAACA[S]AAAACTTCTCAAGAGAACGGGGCAGTGTTGGAAGCGACCGGATATTCAAGCACCCTTCGATTTGTAGTTCCTTGAGCGATGTAAGGTGCTCCATATTGCCTGGTAAGGCATCCCAGTTGCACCGACCAAGCCAGAGCACACGAAGATGAATGAAAGTCACAAGTTCAG

Note: The ambiguity code S, highlighted in red, translates to G or C).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 17 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00011616 133
BS00012000 139
BS00011568 162
BS00009949 164
BS00010828 219
BS00010690 221
BS00009641 230
BS00011942 276
BS00010663 282
BS00018900 319
BS00010290 376
BS00010592 410 1B 20.71
BS00010315 427
BS00011432 469
BS00009291 474
BS00010714 475
BS00016660 493


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 





Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.


-->