Contig Sequence

Contig name: BC000029312 (Nimblegen Contig name: GJKKTUG01DUIV5)

Contains SNP BS00076298 at position 241 (ambiguity code highlighted in red in the sequence below).

GCACCACCAAAGTGTGTGCAAAAAGTTCCCGNNNNNNNTTGTGCAAAAATGATTCTAGCGCAAGCTGGCGAGGCCGGAAGTTAGTGCAGAGTATGCTCACTTTGTAGTCGGCAGAACATCATTGCTGTGATTGTTGGCGGTGGGGAGCTCCGAACATATGAAATTCACGAGCCCAGGGGCGTCCGTGTGGTCCGACCCCTTGGCCCAGGCACGGGCAGGGAATTCCAAGGCGACAGCCGG[R]CAATCATACACTGCCCTGGTGAGCGTCGTCTTCCCCGAGCCGCCGAACCCCACGATGGATATCACACTCAGATTCCTTGGCTTGCTGCCCAGCAGCAGGTCGACGAGCTCCTGCTTGGGCTTGTCGATGCCCACAGGGTGAGTTTTCGGCGCGGGAGGAGTGGCTACTCCGGCTCCGGGCTGCGGCGGAGGACTCCCCCGCGTTGAGGCCGTAGTTCGGCCCTTCGCTCGTGCGCGACTTTGACCCTGTCACG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 12 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00076304 71
BS00076293 123
BS00076294 142
BS00076295 151
BS00076296 172
BS00076297 178
BS00076298 241 3A 0.00
BS00076299 289
BS00076300 318
BS00076301 321
BS00076302 339
BS00076303 340



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->