Contig Sequence

Contig name: BC000028265 (Nimblegen Contig name: GJKKTUG01C3BK8)

Contains SNP BS00073748 at position 214 (ambiguity code highlighted in red in the sequence below).

CGGAAAACTGTGCAACCTCAAAAATCTCACTCTGGCTACTGGTGGTACTGCTGCAAGGGTTGTTCTTTTTGATGGTTCGAGTGACATGTTTTTGCCCATGTTTCTTGAGAGATTTGAGTTGTTGCCTCCCATTTGCATCCTTTCCAGACTTCCAGAGTGGATCGGACAACTCCGCAAAATCTGCATTGTTAAAGTTGCTGTCAATGAACTACC[R]ACTACTGATATTGCTATGCTCACGGGATTACCTTCCCTCACAGTTCTCTGGTTGTCTGTTCAGACTGCTCCTGAGGGAAGGACCGTCTTCAACAATAAGGCATTCCCAGTTCTCAAGTATTTCAAGTTTACTTGTGGTGTACTTTGCATGTCTTTCATGGCAGGAGCCATGCCTGATCTTCGTAGGCTCAAGCTGGTTTTCAACACCCATACCGGGGAGGAGTACGACAACATGCTTGCTGGAATTGAGCACCTTTCAAAACTCCAGG

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 13 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00073745 174
BS00073746 204
BS00073747 212
BS00073748 214 3A 0.00
BS00073749 268
BS00073750 311
BS00073751 313
BS00073752 316
BS00073753 328
BS00073754 345
BS00073755 388
BS00073756 425
BS00073757 427



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->