Contig Sequence

Contig name: BC000023894 (Nimblegen Contig name: CONTIG99028)

Contains SNP BS00061735 at position 518 (ambiguity code highlighted in red in the sequence below).

TGGTTCACTACCGTCCATCAAATATATGAACTGGCTTGTGTTGCTCAGGCAAGAGATTGGGCCAACAATACTGTCCCCCATACCTGGCCTCGTACCGGCCTTCTCTGCTGGTATCAACTCTCTTGAACAGCGTACCAGGTTTGCAGTTTCACCTCCGTAACTGTCAGGTATGTATACACTAGTTGATAGATTGGTGGTAGAGATCTTCTGAAGCGGGCACCTAGTCCATGATTCTTCAAGCGGGATGACATTTAGGCCACCATACCTGTAGTCAATTGCAGTGACCTTGCATAGTCCAAGAATTGGGTGAAGTAGGATGGTATCTGCTTCCCTAGAACATGCTAGCTCCAAGCCAGGTGCTCCGCACGATTGGGGGCTGGTTGCAAGGCGGAACGGAAATCGGATCTCTGTGCCTTCTTCGCTGCACCTTGATGGTGCGCAGTTATGGAAGAAATCTCCATCACCACTTGCTGTGGCTCTGTTGATTCCATAGTTAAGAACAGAGAACAACAGAGCT[R]CAACCAAAGCTTCAAACATTTGTGTGAAAAATGAAGATGAGGAGGAAATGAGATGAAGCTGTGCCTACAAAAACTGAGCTTCTTTTGTAATGTTGAAATCATAAAGAAGAAATATCTTGGCTACCTTGAATCAGTTGGACGGATTCCAACCTTTCTTCCTTATCTTCCTGGA

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.


All SNPs on contig

There are 18 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00061729 32
BS00061732 34
BS00061738 88
BS00061739 91
BS00061722 108
BS00061723 135
BS00061724 263
BS00061725 265
BS00061726 267
BS00061727 301
BS00061728 316
BS00061730 332
BS00061731 334
BS00061733 371
BS00061734 438
BS00061735 518 3A 0.00
BS00061736 540
BS00061737 544


BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 





Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Mark Winfield.


-->