Contig Sequence

Contig name: BC000020642 (Nimblegen Contig name: CONTIG82054)

Contains SNP BS00048491 at position 477 (ambiguity code highlighted in red in the sequence below).

GGCTCACCAGACACGCACCTGCATCTGTGCCGCCTCCACACACCACCCGCCGTGCATAGTAGAACCAACATGGCCATGGCGCCATCCGCGCGAGTGTCGCTGATGCTCGCCGTGGTGCTCGCGTGCGCGCTGCTCGCCACCGGCGGCCTCGTGTGCAATCCGCTCCAGGACAAGACGTGCAAGCCGGGGGACCCCAAGGCGCCCGAGAACACGGAGGAGGGGGGCGGGTTCGGCGCGAGGCTGTCATCGCCGCCCATTCCGGGCCACGGTATGATCGACGGAGACATCGACGACGAGTTGCCGTCGTTCAGCACCCACAAGACCATCCTCGGCCACTGGGAGGATCCGGTGCTCGAAGTCTGACATCTAAGTGCATGCTTGTGTCTTCTTGCATTCCCATTGCTTGTGTAGTTGTGTTGTTGTCCGGAAGAAAGAATGGGACAAAGGAAGAGATGAGAGAGTGAGCGTGTCACGAT[R]ATCGATCCACGCTAGCTGATGACTAAATTTGCCAGTTGTCCCTGTTAATATCGTGGACA

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 8 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00048484 204
BS00048485 246
BS00048486 250
BS00048487 378
BS00048488 390
BS00048489 444
BS00048490 459
BS00048491 477 3A 0.00



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->