Contig Sequence

Contig name: BC000014271 (Nimblegen Contig name: CONTIG15614)

Contains SNP BS00030652 at position 337 (ambiguity code highlighted in red in the sequence below).

CTGTATTTTTGCCGAGCTTCTTAATGGAAAGCCAATCCTGCCAGGAAAGAATGAGCCGGAGCAGCTGACCAAAATTTTCGAGCTTTGTGGCACCCCTGACGAGTTAATCTGGCCTGGTGTCACTAAGATGCCATGGTACAACAACTTCAAGCCTCCCCGAGTATTGAAGAGAAAAGTTAAAGATGCCTTTAAACATTTTGACCGGCATGCTCTGGACCTGTTGGAGAGGATGTTAACTTTAGATCCATCTCAGAGGATACCAGCGAAGGAGGCACTTGATGCAGAGTATTTCTGGACTGATCCCTTGCCATGTGATCCGAAAAGTTTGCCGTCATA[Y]GAAGCATCACACGAATTCCAGACTAAGAAAAAACGTCAGCAGCAGAGGCAAGCAGAGGAAGCTGCAAAGCGCCAAAAAATAAATCATCCTCCCCCACATTCTCGCTTGCCTCCGATCCAGCATCCAGGCCAATCGCACCAGATCAGGCCTGGCCATGCGCCACCTGTGGCAGGTGGCCCGAGCCACTATGCAAAACCTCGAGGACCTGGAGGGCCTAACAGGTACCCGCAAGGTGGAAACCAAGGCGCAGGCTATAATAACCCGAACCGCGGAGGGCAGGGCAGCGGCTACGGGAGCGCCCCGTATCCTCAGCAAGGCAGAGGACCTCCTCCGTTCCCTGCAGCAAGTGGTCCACGTGGTAGTGCTGGCAGTGGATATGGAGTCGGCGGGCCAAATTACCCACCAGGTGGTCCGCCATATGGCACGTCTGGTCCAGGTCGAGGAGGCCCGAACTATCCTCAAGGCGGTTCTCGCAATCAGCAGCAGTATGGTAGCTGGCAATAATATTTGTCATATCACGTCGCGGTGATACGCCCCTCCAGTTGGAGTATTTTTATTTGTAGAATCTTTGCTGTTCAAATTCTACTTTCTGTGATTGTTGCGCAACAGCTCTTAAGGTACGTCCTTTATGATTCAAGCTGTATTTTATCAATGTATAAACTGAGATTGTAGCAGAACAGGCTATTGCAGTGTGTCGTTTATGATTCAATTTGTATGTTATGAATACACGAAATGTATAATCACCTTATGATTCAAGCTGTATGTTATGAATGTATGACCATTAAT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 11 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00030652 337 3A 155.07
BS00030653 506
BS00030654 622
BS00030655 852
BS00030656 856
BS00030657 860
BS00030658 863
BS00030659 867
BS00030660 922
BS00030661 950
BS00030662 966



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->