Contig Sequence

Contig name: BC000011891 (Nimblegen Contig name: CONTIG00414)

Contains SNP BS00023273 at position 891 (ambiguity code highlighted in red in the sequence below).

GGCGAACAAGACGAAGGTGACGCCTTGCTTAGCAGTAAATATTATTGTTCTTCGAAACAAAAGAGTCGGGAGGAGGACTCAAGCAGTGAAGAAAGCTCAGTTTGTGACCAAGACAAAGCAATTTCTTTGCACCTATCTCAGGTGAGATCCTTTGCATTCTGTGGGGATGTTGGAAGGATCCCTGATCTTTCAGATCACTTCAAACTTGTACGGGTGCTAGATCTCAGTGATGTCAATGGCTTGCAAAACGAACAACTGGGAAGCATTGGAAGTTTGTCTCTGCTGAGGTACTTGGCCCTTGGCGGGGCCGATGTCACAGAGCTGCCTCAACAAATTATGGAACCTGACCACCTGTCTACCTTAGATTTAAGGCAGACTGAGGTAAATAAATTACCAGAATTTAAGGGCACGAAGTTGGTGTGTTTGCTTGCAAATGGTCTCACAATACCGGGAGCGGGAGGAGGAATGGGGGAAATGGAAAAATTGGAGGAACTATCAACGGTCTGTCTAGGTGGTGATGGCTCACTTGCTGACAATGTGGCAGGACTTGTTAGAAAGTTGATGCGGCTGCGGATGCTTGGGGTGAGATTTAGGATTACGTATAATAGTACTGCAGAAGAAGCGGAACGGCAGGGCATCAAGCATTTGGTGGAGGAGGTGGGGAAATCAAACTTGCAGTTCCTTTTTCTTGATGAATACCCTCATCGTCTGCTCGACTTACTTGTTGATTGCTGGAGCCATGTAAGGCCACGTTACCTGCGGAAATTTGAGCTAAGATTGGATTGGCTATTGTGCCCCCTAAAAGTCCCACAGGAGATCTCTTCCCTTGTTGACCTCACTCACTTGCATATCGGACTTTCAATAGTAGATGCAGAAGGTGTCCGCGCCCT[Y]GGGGGGCTGCCAAAGTTAGTCCTCCTAAAATTGTATTCACTGCGGCCACAACACATGGCCTCACCGGTGAACCACAAAGCCCAGCAAGGTTGTCCGTGAGCAGCAAGGATGGCTTTCAGCGCCTCAAGGTGTTCTGGTACGTCTGCGAGCATGGCGCTTGGACGGGGCTGCAGTTTGAAGAAGGCTCCATGCCGCACCTCCGAAGGCTTCTCATTGACTTCCAGTCATCGGAGGAT

Note: The ambiguity code Y, highlighted in red, translates to C or T).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 30 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00023249 137
BS00023250 154
BS00023251 233
BS00023252 237
BS00023253 238
BS00023254 250
BS00023255 268
BS00023256 271
BS00023257 297
BS00023258 344 4D 0.00
BS00023259 455
BS00023260 464
BS00023261 510
BS00023262 515
BS00023263 546
BS00023264 555 3D 184.23
BS00023265 608
BS00023266 623 3D 178.65
BS00023267 651
BS00023268 687
BS00023269 729
BS00023270 783
BS00023271 812
BS00023272 883
BS00023273 891 3A 255.30
BS00023274 995
BS00023245 1054
BS00023246 1055 7D 27.17
BS00023247 1067 7D2 15.98
BS00023248 1077



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->