Contig Sequence

Contig name: BC000006847 (Nimblegen Contig name: CONTIG08475)

Contains SNP BS00011516 at position 285 (ambiguity code highlighted in red in the sequence below).

GTCATGAAAAGCCTGAGGTGACTGCGGTATCCATTGAGCCAAATTTTGCCTCGTATCTTTTCAGCGAGTATCTGTCAAATTCGTCAGGCACGATGTTGCCTGAAGGTGTCTTCCTTGGAAGATTCGTTGAAGGCCATGGATGGTATCAAAGTTGCTAATGGTCTTGAATGCAAGATATCCTGCAAGACCTCTAAGGTCTCCTATGTCCTTGACACCGAAGATTTCTTGTTTCGGTTGAGAAAGAGGAGGAGGCTTTCACCTGGTGGAAATGTGGCCGACAAGTC[R]CCGACCTCCAAAAAATATGATGCAAAAGTGCAGCGCTTTCATTTATTTCTATCCAAGCCTTAAGAGGGCCGTAGGCAAAAAACATTGACATTGTATCCAAATCAGGAGATGCTGCTGGGGTCGTGACCGCCTTGCTCTTTGCTTCGACAGTGACAAGAAGAATAACAATAATCAGCTGGGCGCTGGATAGATGATATACCCGGTAAATACAGCAAAGCAAAGCATGTTAGGGCCACCTCGGTCAGCCTTAGGCCGCGCCGAAAAAGATGTGTGTGTGTTTGTAAATATGTACTGGCAGAAGAAGGATGTTGTTTGTTCTGTTAACCTGTTATTACCTGTAGTGTCTTTTTTGGTCGTCGTAGAAGGAGGAGAAGGATTCTGTTGAAGTGATGATGATCACCATTTGTTGATGCTGGTATAGGTCTCTTTGTTATGTCGGGTTGACCGTCGGTTTTTCGGTTCAAGATATGTAGCCTTGGTCA

Note: The ambiguity code R, highlighted in red, translates to A or G).

The highlighted SNP has not been mapped. Any other SNPs on the same contig are reported in the table below.



All SNPs on contig

There are 15 putative SNPs on this contig. If mapping information obtained from varietal crosses is available, it is shown in the table. When the SNP has NOT been mapped in a particular cross, the corresponding fields in the table are left blank.

SNPs id Position Map Location AxC cM Map Location SxR cM Map Location SxO cM
BS00014788 253
BS00011516 285 3A 0.57
BS00014686 369
BS00018686 369
BS00019788 370
BS00021009 372
BS00019695 373
BS00017194 374
BS00018069 375
BS00013974 376
BS00020063 401
BS00014799 445
BS00016288 450
BS00020231 451
BS00019677 561



BLAST information

To BLAST the above sequence against our SNP database click on the 'Query' button below. You may select an e-value cut-off for this search.

e-value cutoff 


******************************************************************************************************************************************************

Alternatively, if you wish to perform a BLASTN search with this sequence, please use the drop-down fields below to select the parameters (database and e-value cutoff value) you wish to use and then click the grey 'BLAST' button.   At present your search can only be performed against Brachypodium distachyon, rice ( Oryza sativa ) or rye ( Secale cereale ) libraries.   However, this site is actively being worked on and we hope to be able to add additional libraries.

BLAST input parameters Database: 


e-value cutoff: 






Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

Maintained by Paul Wilkinson.


-->